Báo cáo y học: "nfluence of atorvastatin on coronary calcifi

Báo cáo y học: "nfluence of atorvastatin on coronary calcifications and myocardial perfusion defects in systemic lupus erythematosus patients: a prospective, randomized, double-masked, placebo-controlled study" docx

... RESEARC H ARTIC LE Open Access Influence of atorvastatin on coronary calcifications and myocardial perfusion defects in systemic lupus erythematosus patients: a prospective, randomized, double-masked, placebo-controlled ... analysis and interpretation of the data, and manuscript preparation. KG, HD, LTP, and MK acquired and analyzed the data. PP...

Ngày tải lên : 12/08/2014, 17:22

9
262
0

Báo cáo y học: "Comparison of cooling methods to induce and maintain normoand hypothermia in intensive care unit patients: a prospective intervention study" ppsx

... water-circulating blankets, gel-coated water circulating pads and intravascular cooling are equally efficient in inducing hypothermia and normothermia. For maintaining the target temperature, intravascular ... normothermia in ICU patients. Cooling using water- circulating blankets, gel-coated water circulating pads and intravascular cooling was equally efficient in inducing hy...

Ngày tải lên : 13/08/2014, 08:20

9
462
0

Báo cáo y học: "Effect of antioxidants on knee cartilage and bone in healthy, middle-aged subjects: a cross-sectional study" ppt

... body mass index, and tibial cartilage volume. c Change in tibial plateau bone area (mm 2 ) per standard-deviation increase in vitamin C/vitamin E intake before and after adjusting for energy intake, ... in tibial cartilage volume (mm 3 ) per standard-deviation increase in vitamin C/vitamin E intake before and after adjusting for energy intake, age, gender, body mass index, an...

Ngày tải lên : 09/08/2014, 10:20

9
491
0

Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf

... binding of factor X and its Gla-containing fragments to membranes containing 25 mol% PtdSer in the presence of 10 m M Ca 2+ obtained by evaluation of association and dissociation phases (I) and ... human protein C and activated protein C containing the c-carboxyglutamic acid and trailing helical stack domains of protein C replaced by those of human coagulation factor IX....

Ngày tải lên : 08/03/2014, 23:20

6
401
0

Báo cáo Y học: Expression of glucose transporter-2, glucokinase and mitochondrial glycerolphosphate dehydrogenase in pancreatic islets during rat ontogenesis potx

... frozen at )80 °C until the insulin assays. Insulin was measured by the radioimmun o- assay method of Herbert et al. [15], using rat insulin as a standa rd. RNA isolation and Northern-blot analysis Total ... change in A 412 before the addition of oxalacetate (which is acetyl-CoA hydrolase activity) from the change in A 412 after addition of oxalacetate. Succinate dehydrogen...

Ngày tải lên : 31/03/2014, 15:20

9
469
0

Báo cáo y học: "Absence of autoantibodies against correctly folded recombinant fibrillin-1 protein in systemic sclerosis patients" pps

... 3 Analysis of immunoreactivity of sera from systemic sclerosis patients and healthy controls of Caucasian originAnalysis of immunoreactivity of sera from systemic sclerosis patients and healthy ... (rF16) and carboxy-terminal (rF6H) halves of human fibrillin-1 were analyzed by electron microscopy after rotary shadowingRecombinant amino-terminal (rF16) (a) and carboxy-t...

Ngày tải lên : 09/08/2014, 07:20

6
361
0

Báo cáo y học: "Identification of intra-group, inter-individual, and gene-specific variances in mRNA expression profiles in the rheumatoid arthritis synovial membrane" pot

... compo- nents of the pannus [2-8] and participate in maintaining joint inflammation, degradation of extracellular matrix (ECM) com- ponents, and invasion of cartilage and bone [2,4] as well as fibrosis of ... Szekanecz Z, Koch AE: Update on synovitis. Curr Rheumatol Rep 2001, 3:53-63. 65. Kawakami A, Urayama S, Yamasaki S, Hida A, Miyashita T, Kamachi M, Nakashima K, Tanaka...

Ngày tải lên : 09/08/2014, 10:23

16
627
0

Báo cáo y học: " Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency" docx

... receptors in a ligand-dependent manner and enhances transcriptional activation via his- tone acetylation and recruitment of general transcription factors and additional cofactors (reviewed in [28]). NCoA3 ... latency and that IRF8 may contribute to the maintenance of the latent state in the promonocytic cell line. Implication of these factors in the maintenance or reac...

Ngày tải lên : 13/08/2014, 09:21

14
315
0

Báo cáo y học: "Expression of leukemia inhibitory factor (LIF) and its receptor gp190 in human liver and in cultured human liver myofibroblasts. Cloning of new isoforms of LIF mRNA" pdf

... : tacacagcccagggggagccgttccccaacaacctggacaagctatgtggccccaacgtgacggacttcccgcccttccacgccaac ggcacggagaaggccaagctggtggagctgtaccgcatagtcgtgtaccttggcacctccctgggcaacatcacccgggaccagaa gatcctcaaccccagtgccctcagcctccacagcaagctcaacgccaccgccgacatcctgcgaggcctccttagcaacgtgctgtgc cgcctgtgcagcaagtaccacgtgggccatgtggacgtgacctacggccctgacacctcgggtaaggatgtcttccagaagaagaag ctgggctgtcaactcctggggaagtataagcagatcatcgc...

Ngày tải lên : 13/08/2014, 13:20

10
287
0

Báo cáo y học: "Effects of Flurbiprofen on CRP, TNF-α, IL-6, and Postoperative Pain of Thoracotomy"

... Surgical trauma induces an inflammatory state characterized by the release of both proinflammatory and antiinflammatory proteins. Proinflammatory cy- tokines induce not only a local inflammation ... 1. Department of Thoracic Surgery, Konya Education and Research Hospital, Konya, Turkey; 2. Microbiology Laboratory, Konya Education and Research Hospital, Konya, Turkey  Corresp...

Ngày tải lên : 25/10/2012, 11:10

6
622
0