Báo cáo y học: "Characterization of a novel and spontaneous mouse model of inflammatory arthritis" pptx

... S, Ohmura K, Mimori T, Matsuda F, Iwamoto T, Momohara S, Yamanaka H, Yamada R, Kubo M, Nakamura Y, Yamamoto K: A regulatory variant in CCR6 is associated with rheumatoid arthritis susceptibility. Nat ... cytokine CBA assays and the majority of the flow cytometry. JW was critical in compiling and analyzing the clinical data, performed most of the Ig ELISAs and designed and condu...

Ngày tải lên: 12/08/2014, 17:22

... 191:313-320. 7. Sakaguchi N, Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selection due to a mutation of the ZAP-70 ... Characterization of a novel and spontaneous mouse model of in ammatory arthritis. Arthritis Research & Therapy 2011, 13:126. Cuzzocrea Arthritis Research &...

Ngày tải lên: 12/08/2014, 17:22

... K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic identification and bio- logical validation of neuroendocrine ... could mechanis- tically promote neurodegeneration by unleashing NMDA and AMPA excitotoxic injury. Thus a mecha- nism by which abnormal energy metabolism may have an influence on cli...

Ngày tải lên: 03/11/2012, 10:52

... to positive symmetry, and the only possible group delay is given by (30). Finally we relieve the demand for exactly linear-phase and ask only for approximately constant magnitude response and approximately ... delay and approximately linear-phase frequency response in the passband and the transition band and (ii) Design of synthesis prototype filter such that the filter bank pairs...

Ngày tải lên: 21/06/2014, 19:20

... increased than nor- mal latency of a and b waves (melancholic patient) All recordings are within normal range. Annals of General Psychiatry 2005, 4:7 http://www.annals-general-psychiatry.com/content/4/1/7 Page ... imped- ance was <4 kohms. All patients came from North Greece (Latitude 40–40.1° North). Statistical analysis It included Analysis of Covariance (ANCOVA) with age as a...

Ngày tải lên: 08/08/2014, 21:20

... chemokines has been found in many inflammatory disorders, including hepatic disease, multiple sclerosis, transplant rejection and inflammatory bowel disease [4]. Analysis of synovial tissue, synovial ... and other chronic inflammatory disorders. Keywords: chemokines, rheumatoid arthritis, synovial tissue 97 21. Ogata H, Takeya M, Yoshimura T, Takagi K, Takahashi K: The role of m...

Ngày tải lên: 09/08/2014, 01:23

... subsequently horseradish peroxidase-conjugated Table 1 Primers used Molecule Sense Antisense β-actin 5'-AGGCCAACCGTGAAAAGATG-3' 5'-ACCAGAGGCATAC AGGGACAA-3' IFN-γ 5'-GAAAGACAACCAGGCCATCAG-3' ... 5'-GAAAGACAACCAGGCCATCAG-3' 5'-TCATGAATGCATCCTTTTTTGC-3' IL-4 5'-CCACGGAGAACGAG CTCATC-3' 5'-GAGAACCCCAGACTTGTTCTTCA-3' IL-17 5&ap...

Ngày tải lên: 09/08/2014, 13:22

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC (b) t WGFTLKG...

Ngày tải lên: 09/08/2014, 23:20

... feed orally and by gastrostomy against the recommendations. This happened for 2 days and the patient started to deteriorate, having a high grade fever, productive cough and dyspnoea and died of sepsis ... from Sub Saharan Africa. This fact may well be due to the rarity of the condition, such that only a few cases are encountered and managed. But with the lack of therapeuti...

Ngày tải lên: 10/08/2014, 09:22

... 5(4):557-572. 42. Sakakura C, Mori T, Sakabe T, Ariyama Y, Shinomiya T, Date K, Hagiwara A, Yamaguchi T, Takahashi T, Nakamura Y, Abe T, Inazawa J: Gains, losses, and amplifications of genomic materials in ... hybridization) as a synonym for methods generating copy number data including classical array CGH tiling microarrays or SNP microarrays. Although a number of software tool...

Ngày tải lên: 10/08/2014, 09:22