Báo cáo sinh học: "DeBi: Discovering Differentially Expressed Biclusters using a Frequent Itemset Approach" doc

... Wong MA: Algorithm AS 136: A k-means clustering algorithm. Applied Statistics 1979, 28:100-108. 4. Hartigan JA: Direct Clustering of a Data Matrix. Journal of the American Statistical Association ... Burdick D, Calimlim M, Gehrke J: MAFIA: A Maximal Frequent Itemset Algorithm for Transactional Databases. Data Engineering, International Conference on 2001, 0:0443. 29. Chia BKH, Karut...

Ngày tải lên: 12/08/2014, 17:20

... manuscript. All authors read and approved the final manuscript. Authors’ information The International Acute Care Research Collaborative (IACRC), located within the University of Maryland Global ... Abstract A recent important global meeting to set the international action agenda concerning non- communicable diseases (NCDs) failed to draw substantial attention from the ... health-...

Ngày tải lên: 18/06/2014, 18:20

... wavelets approaches [1, 2], stochastic approaches [3], principal component analysis-based approaches [4, 5], and variational approaches [6]. We refer the reader to the literature [7, 8] and references ... I-divergence as data fitting term and the total variation seminorm as regularizer. A variational model involving curvelet coefficients for cleaning multiplicative Gamma noise was considered i...

Ngày tải lên: 21/06/2014, 16:20

... BALB/c mice Elias A Rahal † , Natalie Kazzi, Ahmad Sabra, Alexander M Abdelnoor and Ghassan M Matar *† Abstract Background: Treatment of Escherichia coli O157:H7 infections with antimicrobial ... phenolics, anthocyanins, and organic acids, against Escherichia coli O157:H7. Int J Food Microbiol 2010, 139:102-107. 27. Ogawa M, Shimizu K, Nomoto K, Takahashi M, Watanuki M, Tanaka R, Tanaka T,...

Ngày tải lên: 12/08/2014, 17:20

... results in a highly-efficient parsing architecture that is realized as a cascade of finite-state transducers and that pursues a leftmost longest-match pattern- matching strategy at each level of analysis. Despite ... The fragmentary and partially ill- formed nature of such spoken data makes them harder to analyze than written data such as the Penn treebank typically used as gold standard....

Ngày tải lên: 17/03/2014, 07:20

... USA, June 2008. c 2008 Association for Computational Linguistics Dictionary Definitions based Homograph Identification using a Generative Hierarchical Model Anagha Kulkarni Jamie Callan ... semi-supervised models are non-conclusive. Our post-experimental analysis reveals that the parameter updation process using the unlabeled data has an effect of overly separat- ing the two o...

Ngày tải lên: 31/03/2014, 00:20

... cDNA fragments identified by cDNA-AFLP, namely ACAG2-1, ACCT8-1, ACCT2-1, and ACCT13. The forward primers are (5 ’GA ACAAAAAAATG- GAGTTTTA3’), (5’CGAACTCCCAACTGGCTTTC3’ ), (5’CTCTG GAAAGGAGAGCAATGTC3’), ... GAAAGGAGAGCAATGTC3’), and (5’GAAC GCTTTGATGAGAATAGAGA3’) and the reverse pri- mers (5’GTCATTGCTCCTAATAAGGT3’ ), (5’ CTCC TCCAGAAGCAAATAGTTTC3’ ), (5’ CGAACAAA TT GGTGTATCC3’ ), and (5’CT A...

Ngày tải lên: 11/08/2014, 11:21

... (Beckman Coulter, Brea, CA). After quantifica- tion, the RNA was cleaned using an RNeasy MinElute Cleanup kit (Qiagen, Valencia, CA). RNA was stored at -80°C until used. Microarrays and data analysis For ... fertilization in Nicotiana tabacum,Huangand Russell [26] noted dramatic changes in cytoskeletal reor- ganization. It has been postulated that abundant actin in the embryo sac, also call...

Ngày tải lên: 11/08/2014, 11:21

... leukemias (AML). Additional data file 2 is based on a dataset from a publicly available lung cancer study of Bhattacharjee et al. [29,30]. It also originated from Affymetrix HG U9 5A arrays and con- tains ... of Bhattach-arjee et al .A dataset from a publicly available lung cancer study of Bhattach-arjee et al. [29,30]. It also originated from Affymetrix HG U9 5A arrays and contains...

Ngày tải lên: 14/08/2014, 14:22

... Horikawa Y, Hara K, Osawa H, Furuta H, Hirota Y, Mori H, Jonsson A, Sato Y, Yamagata K, Hinokio Y, Wang HY, Tan- ahashi T, Nakamura N, Oka Y, Iwasaki N, Iwamoto Y, Yamada Y, Seino Y, Maegawa H, Kashiwagi ... Sandbaek A, Lauritzen T, Hansen T, Nurbaya S, Tsunoda T, Kubo M, Babazono T, Hirose H, Hayashi M, Iwamoto Y, Kashiwagi A, Kaku K, Kawamori R, Tai ES, Pedersen O, Kamatani N, Kadowaki...

Ngày tải lên: 14/08/2014, 21:20