Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt

... version ofJane. Values of the se parameters were systematicallyevaluated and the best values found are used as defaults.Jane can import its files in either Tarzan or a Nexus-based format. A file ... implementation of a new software tool, called Jane, for the study of historical associations. This problem arises in parasitology (associations of hosts and parasites), molecularsystematics (associations ... Access Jane: a new tool for the cophylogeny reconstruction problemChris Conow2, Daniel Fielder1, Yaniv Ovadia1, Ran Libeskind-Hadas1*AbstractBackground: This paper describes the theory and...

báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt

... Broussais – Hôtel Dieu, Paris. Partner manager – Pierrre DurieuxItaly: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna. Partner manager ... manager – Roberto GrilliItaly: Center for the Evaluation of Effectiveness of Health Care (Ce.V.E .A. S.), Modena. Partner manager – Alessandro Liberati The Netherlands: Centre for Quality of Care ... of practice are the fac-tors that affect practice patterns and explain the variationin the effectiveness of different QI interventions in chang-ing practice patterns; they are usually categorized...

Báo cáo sinh học: "CHSMiner: a GUI tool to identify chromosomal homologous segments" pot

... is the maximal gapsize (number of unmatched genes) allowed between twoadjacent matched genes (Figure 1). Another advantage of the algorithm is that the greedy search has a fast computa-tional ... and randomly ordered genomes. When the sizeof the CHS m is fixed, the smaller the maximal gap size is, the harder it can be observed. Therefore, the value can betreated as the p-value for the ... al. [11] have pre-sented a mathematical treatment for max-gap gene clus-ters. On the basis of their conclusion, CHSMiner performsanalytical test that can greatly reduce the computationalburden....

Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

... beobtained from the KEGG atlas. However, withoutquantitative analysis, there are no clues about the quality of these relations. To ﬁll the gap, we proposean analytical framework for the interpretation ... that share the same compounds.In general, a reaction consists of multiple reactant pairs, and the one that appears in a KEGG metabolic pathway is called a main pair. To build a global reaction network, ... pathwaysand networks. Trends Biochem Sci 33, 101–103.33 Okuda S, Yamada T, Hamajima M, Itoh M, KatayamaT, Bork P, Goto S & Kanehisa M (2008) KEGG atlasmapping for global analysis of metabolic...

Báo cáo sinh học: "On a multivariate implementation of the Gibbs sampler" pps

... either the scalar or block sampling strategies was compared on the basis of the simpleestimator of the mean of marginal posterior distributions (the raw average of the elements ... Alternatively, when the integralhas a closed-form solution, the mixture estimator can take the form The Monte-Carlo variances of the mixture estimator of the mean of the ... strategy is compared with the traditional scalar implementation of the Gibbs sampler. A data file based on a univariate animal model with 250 individuals (all with one record,...

Báo cáo sinh học: "iTriplet, a rule-based nucleic acid sequence motif finder" pptx

... techniques, large amounts ofsequencing data are readily available for analysis. Natural biological signals are intrinsically highlyvariable making their complete identification a computationally challenging ... promoter+5' UTR RemarksiTriplet CCATATTAGGACATCTGCGT <20,1> modelPMSprune CCAAATTTG Ref. [17]MITRA CCATATTAGGACARef. [14]Published CAGGATGTCCATATTAGGACATC Transfac ID: R004663'UTR ... 14:1188-1190.20. Salgado H, Gama-Castro S, Martinez-Antonio A, Diaz-Peredo E,Sanchez-Solano F, Peralta-Gil M, Garcia-Alonso D, Jimenez-Jacinto V,Santos-Zavaleta A, Bonavides-Martinez C, Cllado-Vides...

... generates easy-to-navigate, annotated HTML pages as output. (a) The L2L web interface. (b) The Results summary page displays each list from the database that significantly matched the data, along ... the GNU General Public License.L2L Microarray Database The need for a standardized format for presenting and storingmicroarray data from disparate platforms has been recog-nized for several ... shows that, at least for the diabetic nephropathy dataseton the U95Av2 platform, a simple calculation of p valuesbased on the binomial distribution gives a good approxima-tion of the actual likelihood...

Báo cáo sinh học: " Vanishing heat conductivity limit for the 2D Cahn-Hilliard-Boussinesq system" ppt

... Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon.Vanishing heat conductivity limit for the ... Jishan Fan21Department of Mathematics, Zhejiang Normal University,Jinhua 321004, People’s Republic of China2Department of Applied Mathematics, Nanjing Forestry University,Nanjing 210037, ... Republic of China∗Corresponding author: jzhong@zjnu.cnEmail address:fanjishan@njfu.com.cnAbstractThis article studies the vanishing heat conductivity limit for the 2D Cahn-Hilliard-boussinesq...

Báo cáo sinh học: " An advanced Bayesian model for the visual tracking of multiple interacting objects" pptx

... 5[18], a variance reduction technique called Rao–Blackwellization has beenused to improve the accuracy. A random ﬁnite set (RFS) approach can be used as an alternative to dataassociation methods, ... andtherefore with an analytical expression known as the Kalman ﬁlter. Thisassumption arises from the fact that the object dynamics can be accept-ably simulated by a constant velocity model with Gaussian ... technique assumes that the random variables have a special structure that allows to analytically mar-ginalize out some of the variables conditioned to the rest ones, improving the estimation in...

Báo cáo sinh học: " Shell Vial culture Assay for the rapid diagnosis of Japanese encephalitis, West Nile and Dengue-2 viral encephalitis" pdf

... Research, Pondicherry – 605 006, IndiaEmail: Rangaiah S Jayakeerthi* - srjkeerthi@yahoo.com; Raghava V Potula - raghava@potula.net; S Srinivasan - srinivasan@jipmer.edu; S Badrinath - sbadrinath@rediffmail.com* ... Japanese encephalitis, West Nile and Dengue-2 viral encephalitisRangaiah S Jayakeerthi*1, Raghava V Potula1, S Srinivasan2 and S Badrinath1Address: 1Department of Microbiology, Jawaharlal ... Jawaharlal Institute of Post-graduate Medical Education and Research, Pondicherry – 605 006, India and 2Department of Pediatrics, Jawaharlal Institute of Post-graduate Medical Education and...

Xem thêm

Từ khóa: a new leader for the ndp a new approach for the morphological segmentation báo cáo sinh học phân tử a new approach to the maximum flow problem a new approach to the shaded picture problem Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ