Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx
Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx
... includes
base 10 log-transformation as well as normalization to
mean 0 and variance 1. For the data that contains
negative values, we do not perform log-transformation.
In microarray data, the gene dimension ... classification. Both ANMM and CBR are
suitable for dealing with microarray data, which usually contain
noisy information and only a small number of training samples are
av...
Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt
... [3,10,11,17,18]. Finally, we
also estimate the computational complexity of the pro-
posed method.
Table 1: Datasets.
Dataset name Dataset details Dataset goal
Design set 66 human miR-mRNA duplexes published ... regulatory motifs
in human promoters and 3'UTRs by comparison of several
mammals. Nature 2005, 434:338-345.
14. Watanabe Y, Yachie N, Numata K, Saito R, Kanai A, Tomita M: Com-...
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx
... was administered to animals viral repli-
cation per se did not appear to have an overt pathogenetic
affect, rather a T-cell lymphoma eventuated [62], presum-
ably as a result of oncogene activation. ... vectors is that of insertional mutagenesis
and oncogene activation.
Insertional mutagenesis and oncogene activation
As discussed above, oncogene activation can occur either
by transcriptio...
Báo cáo sinh học: "Promoter architecture and the evolvability of gene expression" pdf
... of variation in gene expression
in Arabidopsis thaliana. Genetics 2005, 171:1267-1275.
29. Hovatta I, Zapala MA, Broide RS, Schadt EE, Libiger O, Schork
NJ, Lockhart DJ, Barlow C: DNA variation ... selection in Caenorhabditis elegans. Nat Genet
2005, 37:544-548.
20. Rifkin SA, Houle D, Kim J, White KP: A mutation accumula-
tion assay reveals a broad capacity for rapid evolution o...
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps
... 4
pMIR-
REPORT
3' UUCCCUAAGGACCCUUUUGACCUG 5'
||||||||||
5' CUUGAAGAGAUAAGAAAACUGGAU 3'
5' CUUGAAGGGAAGACAAAACUGGAU 3'
5' UUUGAAGAGAUAAGAAAACUGGAU 3'
5' CUUGAAGAGAAAACAAAACUGGAU ... |||||||
5' UCA-AUUCAGUGGAUGGCAACUGGAA 3'
5' CAA-AUUCAGUGGAUGGCAACUGGAA 3'
5' UUA-AUUCAGCGGAUGGCAACUGGAA 3'
5' AUAUAUUCAGUGGAUGGCAACU...
Báo cáo y học: "Developing a systems-level understanding of gene expression" doc
... Durham, USA) described a
computational approach for extracting gene- expression
information from confocal images of such experiments, with
emphasis on Arabidopsis roots. His approach involves
mapping ... regulating gene
expression, as well as the extent of post-transcriptional
regulation. Epigenetic modifications, the dynamic nature of
chromatin and its role in regulating gene ex...
Báo cáo y học: "Correction: A DNA microarray survey of gene expression in normal human tissues" pdf
... corrected data file has been
deposited to the Stanford Microarray Database (SMD) and
Gene Expression Omnibus (GEO) repositories. Second, we
have identified a ‘frame-shift’ in the Additional data file ... 2
(Sheet 5) data set; the corrected data file has been deposited
to the supplemental site.
Additional data files
Additional data file 2 contains a corrected list of the va...
Báo cáo y học: " Indirect genomic effects on survival from gene expression data" doc
... considered. Gene and protein data
can also be included in the same analysis, providing a more
comprehensive analysis of pathways.
Materials and methods
Path analysis and graphical models
The basic idea ... Core Team: R: A Language and Environment for
Statistical Computing. Vienna, Austria: R Foundation for Statistical
Computing; 2007.
46. R Package addreg for Additive Hazard Re...
Báo cáo y học: "Consensus clustering and functional interpretation of gene-expression data" docx
... used a
repeated microarray control element Amersham Score Card
(ASC) dataset as a semi-synthetic validation standard. We
also used an experimentally derived microarray dataset for
cross-cluster -method ... the EPSRC and the MRC in
the UK. We would also like to thank Richard Jenner for the viral gene
expression dataset and Antonia Kwan for preparing the ASC dataset. These
method...
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf
... reward rote recall of facts and don't assess a
student's ability to apply knowledge in practice. The
'Teaching Guide' emphasizes structured observation as an
alternative assessment ... Guide' places great emphasis on a mix
of interactive teaching methods to stimulate active stu-
dent participation, such as case-based learning, role plays,
and group discussions....