Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

... includes base 10 log-transformation as well as normalization to mean 0 and variance 1. For the data that contains negative values, we do not perform log-transformation. In microarray data, the gene dimension ... classification. Both ANMM and CBR are suitable for dealing with microarray data, which usually contain noisy information and only a small number of training samples are av...

Ngày tải lên: 12/08/2014, 17:20

11 373 0
Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt

Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt

... [3,10,11,17,18]. Finally, we also estimate the computational complexity of the pro- posed method. Table 1: Datasets. Dataset name Dataset details Dataset goal Design set 66 human miR-mRNA duplexes published ... regulatory motifs in human promoters and 3'UTRs by comparison of several mammals. Nature 2005, 434:338-345. 14. Watanabe Y, Yachie N, Numata K, Saito R, Kanai A, Tomita M: Com-...

Ngày tải lên: 12/08/2014, 17:20

12 621 0
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx

Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx

... was administered to animals viral repli- cation per se did not appear to have an overt pathogenetic affect, rather a T-cell lymphoma eventuated [62], presum- ably as a result of oncogene activation. ... vectors is that of insertional mutagenesis and oncogene activation. Insertional mutagenesis and oncogene activation As discussed above, oncogene activation can occur either by transcriptio...

Ngày tải lên: 14/08/2014, 19:22

13 499 0
Báo cáo sinh học: "Promoter architecture and the evolvability of gene expression" pdf

Báo cáo sinh học: "Promoter architecture and the evolvability of gene expression" pdf

... of variation in gene expression in Arabidopsis thaliana. Genetics 2005, 171:1267-1275. 29. Hovatta I, Zapala MA, Broide RS, Schadt EE, Libiger O, Schork NJ, Lockhart DJ, Barlow C: DNA variation ... selection in Caenorhabditis elegans. Nat Genet 2005, 37:544-548. 20. Rifkin SA, Houle D, Kim J, White KP: A mutation accumula- tion assay reveals a broad capacity for rapid evolution o...

Ngày tải lên: 06/08/2014, 19:21

6 346 0
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

... 4 pMIR- REPORT 3' UUCCCUAAGGACCCUUUUGACCUG 5' |||||||||| 5' CUUGAAGAGAUAAGAAAACUGGAU 3' 5' CUUGAAGGGAAGACAAAACUGGAU 3' 5' UUUGAAGAGAUAAGAAAACUGGAU 3' 5' CUUGAAGAGAAAACAAAACUGGAU ... ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 3' 5' CAA-AUUCAGUGGAUGGCAACUGGAA 3' 5' UUA-AUUCAGCGGAUGGCAACUGGAA 3' 5' AUAUAUUCAGUGGAUGGCAACU...

Ngày tải lên: 11/08/2014, 12:20

12 242 0
Báo cáo y học: "Developing a systems-level understanding of gene expression" doc

Báo cáo y học: "Developing a systems-level understanding of gene expression" doc

... Durham, USA) described a computational approach for extracting gene- expression information from confocal images of such experiments, with emphasis on Arabidopsis roots. His approach involves mapping ... regulating gene expression, as well as the extent of post-transcriptional regulation. Epigenetic modifications, the dynamic nature of chromatin and its role in regulating gene ex...

Ngày tải lên: 14/08/2014, 07:21

3 213 0
Báo cáo y học: "Correction: A DNA microarray survey of gene expression in normal human tissues" pdf

Báo cáo y học: "Correction: A DNA microarray survey of gene expression in normal human tissues" pdf

... corrected data file has been deposited to the Stanford Microarray Database (SMD) and Gene Expression Omnibus (GEO) repositories. Second, we have identified a ‘frame-shift’ in the Additional data file ... 2 (Sheet 5) data set; the corrected data file has been deposited to the supplemental site. Additional data files Additional data file 2 contains a corrected list of the va...

Ngày tải lên: 14/08/2014, 14:22

2 310 0
Báo cáo y học: " Indirect genomic effects on survival from gene expression data" doc

Báo cáo y học: " Indirect genomic effects on survival from gene expression data" doc

... considered. Gene and protein data can also be included in the same analysis, providing a more comprehensive analysis of pathways. Materials and methods Path analysis and graphical models The basic idea ... Core Team: R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing; 2007. 46. R Package addreg for Additive Hazard Re...

Ngày tải lên: 14/08/2014, 08:20

14 290 0
Báo cáo y học: "Consensus clustering and functional interpretation of gene-expression data" docx

Báo cáo y học: "Consensus clustering and functional interpretation of gene-expression data" docx

... used a repeated microarray control element Amersham Score Card (ASC) dataset as a semi-synthetic validation standard. We also used an experimentally derived microarray dataset for cross-cluster -method ... the EPSRC and the MRC in the UK. We would also like to thank Richard Jenner for the viral gene expression dataset and Antonia Kwan for preparing the ASC dataset. These method...

Ngày tải lên: 14/08/2014, 14:21

16 281 0
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

... reward rote recall of facts and don't assess a student's ability to apply knowledge in practice. The 'Teaching Guide' emphasizes structured observation as an alternative assessment ... Guide' places great emphasis on a mix of interactive teaching methods to stimulate active stu- dent participation, such as case-based learning, role plays, and group discussions....

Ngày tải lên: 18/06/2014, 17:20

7 377 0
w