Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

... includes base 10 log-transformation as well as normalization to mean 0 and variance 1. For the data that contains negative values, we do not perform log-transformation. In microarray data, the gene dimension ... classification. Both ANMM and CBR are suitable for dealing with microarray data, which usually contain noisy information and only a small number of training samples are av...

Ngày tải lên: 12/08/2014, 17:20

... [3,10,11,17,18]. Finally, we also estimate the computational complexity of the pro- posed method. Table 1: Datasets. Dataset name Dataset details Dataset goal Design set 66 human miR-mRNA duplexes published ... regulatory motifs in human promoters and 3'UTRs by comparison of several mammals. Nature 2005, 434:338-345. 14. Watanabe Y, Yachie N, Numata K, Saito R, Kanai A, Tomita M: Com-...

Ngày tải lên: 12/08/2014, 17:20

... was administered to animals viral repli- cation per se did not appear to have an overt pathogenetic affect, rather a T-cell lymphoma eventuated [62], presum- ably as a result of oncogene activation. ... vectors is that of insertional mutagenesis and oncogene activation. Insertional mutagenesis and oncogene activation As discussed above, oncogene activation can occur either by transcriptio...

Ngày tải lên: 14/08/2014, 19:22

... of variation in gene expression in Arabidopsis thaliana. Genetics 2005, 171:1267-1275. 29. Hovatta I, Zapala MA, Broide RS, Schadt EE, Libiger O, Schork NJ, Lockhart DJ, Barlow C: DNA variation ... selection in Caenorhabditis elegans. Nat Genet 2005, 37:544-548. 20. Rifkin SA, Houle D, Kim J, White KP: A mutation accumula- tion assay reveals a broad capacity for rapid evolution o...

Ngày tải lên: 06/08/2014, 19:21

... 4 pMIR- REPORT 3' UUCCCUAAGGACCCUUUUGACCUG 5' |||||||||| 5' CUUGAAGAGAUAAGAAAACUGGAU 3' 5' CUUGAAGGGAAGACAAAACUGGAU 3' 5' UUUGAAGAGAUAAGAAAACUGGAU 3' 5' CUUGAAGAGAAAACAAAACUGGAU ... ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 3' 5' CAA-AUUCAGUGGAUGGCAACUGGAA 3' 5' UUA-AUUCAGCGGAUGGCAACUGGAA 3' 5' AUAUAUUCAGUGGAUGGCAACU...

Ngày tải lên: 11/08/2014, 12:20

... Durham, USA) described a computational approach for extracting gene- expression information from confocal images of such experiments, with emphasis on Arabidopsis roots. His approach involves mapping ... regulating gene expression, as well as the extent of post-transcriptional regulation. Epigenetic modifications, the dynamic nature of chromatin and its role in regulating gene ex...

Ngày tải lên: 14/08/2014, 07:21

... corrected data file has been deposited to the Stanford Microarray Database (SMD) and Gene Expression Omnibus (GEO) repositories. Second, we have identified a ‘frame-shift’ in the Additional data file ... 2 (Sheet 5) data set; the corrected data file has been deposited to the supplemental site. Additional data files Additional data file 2 contains a corrected list of the va...

Ngày tải lên: 14/08/2014, 14:22

... considered. Gene and protein data can also be included in the same analysis, providing a more comprehensive analysis of pathways. Materials and methods Path analysis and graphical models The basic idea ... Core Team: R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing; 2007. 46. R Package addreg for Additive Hazard Re...

Ngày tải lên: 14/08/2014, 08:20

... used a repeated microarray control element Amersham Score Card (ASC) dataset as a semi-synthetic validation standard. We also used an experimentally derived microarray dataset for cross-cluster -method ... the EPSRC and the MRC in the UK. We would also like to thank Richard Jenner for the viral gene expression dataset and Antonia Kwan for preparing the ASC dataset. These method...

Ngày tải lên: 14/08/2014, 14:21

... reward rote recall of facts and don't assess a student's ability to apply knowledge in practice. The 'Teaching Guide' emphasizes structured observation as an alternative assessment ... Guide' places great emphasis on a mix of interactive teaching methods to stimulate active stu- dent participation, such as case-based learning, role plays, and group discussions....

Ngày tải lên: 18/06/2014, 17:20