Báo cáo sinh học: " A simple, practical and complete O -time Algorithm for RNA folding using the FourRussians Speedup" docx

... times rather than the absolute times, and we do not incorporate any addi- tional heuristic ideas or optimizations that might be appropriate for one method but not the other. However, we are aware ... interleaving preprocessing with computation can lead to a practical and simple O( n 3 /logn) time RNA folding algorithm. Through further analysis this basic algorithm could...

Ngày tải lên: 12/08/2014, 17:20

... Numerator and denominator of Q(d) are Gaussian random variables. If the standard deviations of both these random variables are much smaller than their mean values, then the mean and the variance of ... detections. We also suggest a method for a threshold selection and the preamble boundary detection in practical applications. A simple and computationally efficient meth...

Ngày tải lên: 22/06/2014, 22:20

... individual records). There- fore, for comparison purposes the data sets were ana- lyzed using two animal thresh old models (standard and new algorithm) and a sire-dam threshold model. Animal model (Anim)  =++XZae with ... sire-dam mode ls, either as a result of biased estimates of additive genetic variance components (animal model) and/ or as a result of lacking ability...

Ngày tải lên: 14/08/2014, 13:21

... Services and other intergovernmental or nongovernmental organizations. In Tanzania, the training has been supported by the NACP, WHO, the National Medical Stores and NGOs. To date, the Uganda RTRC has ... Program (NACP) and the Tanzania Food and Drug Administration (TFDA). In Rwanda, the RTRC is based at the School of Public Health and the Department of Pharmacy in...

Ngày tải lên: 18/06/2014, 17:20

... to http://www.fixedpointtheoryandapplications.com/authors/instructions/ For information about other SpringerOpen publications go to http://www.springeropen.com Fixed Point Theory and Applications © 2011 Yao et al. ... double-net algorithm for nonexpansive semigroups and variational inequality problems Fixed Point Theory and Applications 2011, 2011:101 doi:10.1186/1687-1812-2011-10...

Ngày tải lên: 18/06/2014, 22:20

... 5A) . Characterization of superparamagnetic nanoparticles To demonstrate the formation of superparamagnetic nanoparticles, the as-prepared Fe 3 O 4 solution was dropped on the copper grid coated ... Hybridization probes and type-specific PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Seco...

Ngày tải lên: 21/06/2014, 01:20

... 2008. 5 J. Liang, R. Nagel, and T J. Xiao, “Approximation theorems for the propagators of higher order abstract Cauchy problems,” Transactions of the American Mathematical Society, vol. 360, no. 4, ... solution of 1.1 in a Banach space X: A generates a compact semigroup S· of uniformly bounded linear operators on a Banach space X. The function a · is real valued and...

Ngày tải lên: 21/06/2014, 16:20

... the SNR of the processed speech are achieved. For good performance, lower values for δ and ξ in the lower bands are suggested. 6. Performance Evaluation In order to evaluate the performance of ... histograms from past spectral values below the adaptation threshold over a duration window and choose the maximum noise level to update the noise estimate. The major drawba...

Ngày tải lên: 21/06/2014, 16:20

... summarised as to find the optimal set of transformation parameters which optimises the calcu- lated value of the cost func tion. In our implementation, a global second-order polyno- mial transformation ... a considerable rela- tive loss in resolution in other parts of the histogram. One way to overcome this is to perform a histogram equalisa- tion before the corresponding histo...

Ngày tải lên: 23/06/2014, 01:20

... 250, a population may be maintained either in one location as one population or in separate groups (by cyclical mating). In many conservation programmes, the number of animals ... groups and total population size, the effective population size in circular group mating is larger than

Ngày tải lên: 09/08/2014, 18:22