Báo cáo sinh học: "Breaking the hierarchy - a new cluster selection mechanism for hierarchical clustering methods" pot
Báo cáo sinh học: "Breaking the hierarchy - a new cluster selection mechanism for hierarchical clustering methods" pot
... quadratic in the number of maximal cliques in the data set and linear in the size of the maximum clique. Under the reasonable assumption that both parameters are small in real-world data sets the ... Central Open Access Page 1 of 22 (page number not for citation purposes) Algorithms for Molecular Biology Research Breaking the hierarchy - a new cluster selection...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo sinh học: "Fair, efficient, and power-optimized spectrum sharing scheme for cognitive radio networks" pot
... consumption for the transmission of the CR user’s data file. We also incorporate the dynamic framing process within the SA to make the variable frame size. The parameters used for simulation are mentioned ... channel. The framing is performed before transmission of the data, and the frames of variable size are used depending upon the capacity of channels. For exam...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: "Careful adjustment of Epo non-viral gene therapy for β-thalassemic anaemia treatment" pot
... treatment repeat and may allow sustained Epo secretion and constant patient coverage. Epo gene transfer has already been tested on normal animals and on anaemia animal models such as β-thalassemia ... Hôpital Saint-Louis, 75011 Paris, France Email: Emmanuelle E Fabre - emma.fabre@gmail.com; Pascal Bigey* - pascal.bigey@univ-paris5.fr; Yves Beuzard - yves.beuzard@sls.aphp.fr; Dani...
Ngày tải lên: 14/08/2014, 19:22
báo cáo sinh học:" Assessing the impact of a new health sector pay system upon NHS staff in England" pot
... far in implementing Agenda for Change, and from feedback from key national informants. The rationale for Agenda for Change Most of the NHS trust managers interviewed were in favour of Agenda for ... sterling) has been absorbed in higher pay and prices – mainly pay increases under Agenda for Change and for medical staff. The implementation costs for the new pay system h...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf
... the sys- tem as a whole. The inclusion of feedback and temporal features makes the model dynamic and non-linear rather than static and linear. Testing the hypothesis Building the simulation components ... paper. However, the value of the model is that all stakeholders can enter their own data and parameter assumptions and readily review the outcomes. Implications of the hy...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx
... effect, and causal links. A causal link con- nects a cause variable with an effect variable by a link with a positive or negative charge. A positive link from variable X to variable Y means either ... accepted into a training program to be a specialist, they must then pass a national examination which allows them to apply for one of the approximately 7000 training position...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Improving the implementation of health workforce policies through governance: a review of case studies" pdf
... criteria were read and analysed by two researchers, indepen- dently from each other. For data analysis we developed an analytical framework that was tested by jointly ana- lysing one article. The analytical ... [28]. Participation of health worker associations and unions InCostaRicatheimpactofhospitalmanagement reforms on absenteeism, the sick-leave policy and the design of management...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC HVS GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTA...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: "Comparative embryology without a microscope: using genomic approaches to understand the evolution of development" potx
... understanding the origins of animal diversity. Taking it to the genome The advent of genome-scale datasets provides an exciting new approach for evaluating these views. This approach, which has ... 65.2 http://jbiol.com/content/8/7/65 Garfield and Wray: Journal of Biology 2009, 8:65 between each species is calculated as a proxy for functional divergence relative to the unde...
Ngày tải lên: 06/08/2014, 19:20