Báo cáo sinh học: "Reconstructing phylogenies from noisy quartets in polynomial time with a high success probability" docx

... set. PROOF. Finding a compatible 5-subset needs O(n 5 ) time. In each iteration of inserting a taxon into the current phy- logeny, the algorithm goes through all the remaining taxa to make a selection. ... Central Page 1 of 10 (page number not for citation purposes) Algorithms for Molecular Biology Open Access Research Reconstructing phylogenies from noisy quartets in poly...

Ngày tải lên: 12/08/2014, 17:20

... obtained accurately. In addition, Kanemura et al. proposed a framework for expanding a given image based on an interpolator which is trained in advance with training data by using sparse Bayesian ... global approach is suitable for images of a particular class such as face images and fingerprint images. However, since the global approach requires the assumption that all of the trai...

Ngày tải lên: 18/06/2014, 22:20

... made for females being mated with several males. In this case, partitionings should accommodate for ’linking individuals’ being parents in several families, rather than ... over the dams of the family, k indicates male progeny that are linking individuals, 1 indicates female progeny that are linking individuals and m indicates all other proge...

Ngày tải lên: 09/08/2014, 18:22

... (El Nahass et al, 1974; Genest and Guay, 1979; Hanada and Muramatsu, 1980; Uchida et al, 1986). In humans, on the other hand, an important fragile X site (Fra Xq 27.3) ... efficiency in group A, but it must be considered as a possible cause of repeat breedings, long calving intervals and abortions in individual cases. These assessments...

Ngày tải lên: 09/08/2014, 18:22

... promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGAT- CCCGCGAAATTAATAC and TEHA8: ACACCCATGG- TATATCTCCTTCT, introducing restriction sites for PstI upstream and...

Ngày tải lên: 06/03/2014, 01:20

... enumerate the spatial axes. In Eqs. 10, 11 they do not coincide with each other. The notation ‘‘E a (±) ’’ implies the solution obtained for the X-point located at a- direction in the k-space. At last, ... that may be treated as a shallow hydrogenic one. We shall also discuss an effect of degeneracy removal caused by the presence of a hydrogenlike center in an arbitrary place i...

Ngày tải lên: 22/06/2014, 18:20

... following additional data files are available with the online version of this paper. Additional data file 1 is a table listing genes involved in PBS metabolism or regulation in the 11 genomes of marine ... protein made of a PEII-associated linker (amino terminus) and a PEI- associated CpeD-like linker (carboxyl terminus) [19]. How- ever, closer examination of the amino-terminal pa...

Ngày tải lên: 14/08/2014, 08:20

... Jimenez-Jacinto V, Peralta-Gil M, Santos-Zavaleta A, Penaloza-Spinola MI, Contreras-Moreira B, Segura-Salazar J, Muniz-Rascado L, Martinez-Flores I, Salgado H, Bonavides-Mar- tinez C, Abreu-Goodger C, ... Biol 2006, 335588:: 614-633. 11. Mazon G, Lucena JM, Campoy S, Fernandez de Henestrosa AR, Candau P, Barbe J: LLeexxAA bbiinnddiinngg sseeqquueenncceess iinn GGrraamm ppoossiittiivvee aann...

Ngày tải lên: 06/08/2014, 19:20

... a Marie Curie Intra-European Fellow- ship within the 6th European Community Framework Programme. Martin Paluszewski and Pawel Winter are partially supported by a grant from the Danish Research ... three indices are changed locally such that the parts of the structure before and after the chang- ing indices are fixed. All local index changes between two lattice points can be stored in...

Ngày tải lên: 12/08/2014, 17:20

... dis- putes and lack of engineering infrastructure prevent large areas of the world's population from achieving a reasona- ble health status [5]. Availability of trained health care staff is inequitable across ... countries and their health care professionals should help the plight of sub-Saharan Africa appears locked in a mind-set dominated by gloomy statistics and one-way moneta...

Ngày tải lên: 18/06/2014, 17:20