Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot
Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot
... not for citation purposes)Respiratory ResearchOpen AccessResearch The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine modelMar a del Mar Garc a- Suárez*1, ... In this study, we examined the role of PLY in mediating lung damage in experimental acute bacterial pneumonia induced by S. pneumoniae D39 serotype 2.Methods Murine infectionMice were intranasally ... serotype 2. PLY was estab-lished by staining with anti-PLY rabbit antibodies. Apoptosis was assessed by active caspase-9 staining and in situ TUNEL assay. No staining was observed in lung tissues...
- 10
- 350
- 0
Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot
... have a highoxidative enzyme activity, high capillary density andincreased numbers of mitochondria; in contrast fast-twitch fibres have high glycolytic enzyme activity, lowcapillary density and ... Messina - messinaa@svhm.org.au* Corresponding author AbstractBackground: Ischaemia reperfusion (IR) injury of skeletal muscle, is a significant cause of morbidity following trauma and surgical ... CentralPage 1 of 7(page number not for citation purposes)Journal of InflammationOpen AccessResearch The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal...
- 7
- 400
- 0
Báo cáo y học: "The role of F1 ATP synthase beta subunit in WSSV infection in the shrimp, Litopenaeus vannamei" potx
... alpha/beta chain N terminal domain, ATP synthase alpha/betachain C terminal domain according to the NCBI Con-served Domain Database website. This indicated tha t the deduced protein was a shrimp ... synthase beta subunit plays a role in the WSSV infection.ConclusionsF1F0-ATP synthase complexes play a central role in the synthesis of ATP in all living organisms, which was ori-ginally described ... SDS-1 2% polyacrylamide gel forMALDI (matrix assisted laser desorption/ionization)-TOF combined mass spectrometry (MS) analysis. A BLASTP search of the results against the GenBankdatabase http://www.ncbi.nlm.nih.gov...
- 9
- 363
- 0
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx
... factor binding to the cyclin A promoter was analyzed. Takahashi et al., uti-lizing chromatin immunoprecipitation (ChIP) assays toexamine the cyclin A promoter at various stages of the cellcycle, ... activity during the G0phase (lanes 5 and 6, respectively). Again, the kinase activ-ity associated with cyclin D2 immunoprecipitatedcomplexes appeared to be lower than the kinase activityassociated ... for a scenario where the p21/cyclin D2 ratio has not changed, rather only the abundance of the complex has increased.Another important consequence of the interaction of p21/waf1 with cyclin...
- 17
- 299
- 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... CTTGCATGCCCTGCAGGTCGMutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTGReverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse CATTTTGTCCGCCAAGACTTTTGAATACTT ... binding loop of cystatin A fulfils the same function as the second binding loops of cystatin B andfamily 2 cystatins and also what residues of this loop in cystatin A may participate in the interaction.To ... likely also of cathepsin L. The side chains of Leu73 and Pro74 jointly contribute 45% of the totalunitary free energy of binding of cystatin A to cathepsin B,demonstrating a major role of the...
- 10
- 533
- 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... may in uence the shape and volume of the acyl binding pocketand thereby alter the binding mode and affinity of the enzyme for PAA and derivatives thereof, while maintaining the hydrophobicity of ... The bF24rv mutagenic primer was 5¢-ATAAGTATACGCAGGCGCATACCAGCCAAACTGCGGGCCATTTAC-3¢and the bF57rv mutagenic primer was 5¢-GGAAATCACACCATTATGACCAAAAACCAGCCCGGGATAGGC-3¢. The underlined codons ... using the methyl ester or the amide asacyl donor.It appeared that 6-APA and 7-ADCA were able toefficiently deacylate the phenylglycyl- and p-hydroxyphe-nylglycyl-enzyme of bF2 4A, as indicated...
- 8
- 561
- 0
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc
... (antisense); in the second mutant, Cys239was exchanged for Ala using the primers 5ÂCGTGACTGTACTCCACATCgcTGGTAAGGTTAACGC (sense) and5ÂGCGTTAACCTTACCAgcGATGTGGAGTACAGTCACG (antisense). The mutated bases ... zinc.XANES spectra of wild-type and mutantsAs shown in the following, the interpretation of the EXAFS of the mutant enzymes is confirmed by a comparativeanalysis of the zinc K-edge spectra ... activityand in distinct changes in the zinc ligands. In the His237 fi Ala and Cys239 fi Ala mutants, coenzyme Malso seemed to bind efficiently by ligation to zinc indicatingthat some aspects of...
- 7
- 464
- 0
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... Taiwan;3Department of Pharmacy and Pharmacology, The University of Bath, UKDeacetoxycephalosporin C synthase (DAOCS) catalyses the oxidative ring expansion of penicillin N, the committed step in the ... proposed roles for these residues in binding the carboxylate linked to the nucleus of penicillin N(Arg160 and Arg162) and the carboxylate of the a- amino-adipoyl side-chain (Arg266). The results ... to the proposedmode of penicillin binding by DAOCS [1,12] a key feature of which is that arginines 160 and 162 bind to the carbonyland/or carboxylate of the bicyclic b-lactam nucleus, withthe...
- 5
- 462
- 0
Báo cáo y học: "The role of Probiotics in allergic diseases" pptx
... scores, the use of heat-inactivated Lactobacillus GG was associated withadverse gastrointestinal symptoms and further studyenrollment was thus halted.Another study by Kirjavainen et al suggested ... composition of gut microbiota of allergic infants. a target of bifidobacterial therapy at wean-ing? Gut 2002, 51(1):51-5.8. Kirjavainen PV, et al.: Characterizing the composition of intes-tinal microflora ... supplemen-tation [62] and L. casei strain Shirota did not reduce aller-gic symptoms of Japanese cedar pollen allergy [63].SummaryProbiotics may have a potential role in the prevention andtreatment of...
- 7
- 560
- 0
Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc
... func-tional activity of a glucocorticoid-regulated inflammatorycyclooxygenase. Proc Natl Acad Sci USA 1992, 89:4888-4892.7. Raskin JB: Gastrointestinal effects of nonsteroidal anti-inflam-matory therapy. ... manageacute pain. Moreover, whereas the use of these drugs in the management of acute pain is typically short term (a few days to two weeks), their continuous usage in theseexperiments was a ... tempting to trans-late animal data to our management of patients. However,before doing this, certain points must be considered.Most of the studies in animals have evaluated healing atfairly early...
- 3
- 475
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ