Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot

... not for citation purposes) Respiratory Research Open Access Research The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model Mar a del Mar Garc a- Suárez* 1 , ... In this study, we examined the role of PLY in mediating lung damage in experimental acute bacterial pneumonia induced by S. pneumoniae D39 ser...

Ngày tải lên: 12/08/2014, 16:20

... have a high oxidative enzyme activity, high capillary density and increased numbers of mitochondria; in contrast fast- twitch fibres have high glycolytic enzyme activity, low capillary density and ... Messina - messinaa@svhm.org.au * Corresponding author Abstract Background: Ischaemia reperfusion (IR) injury of skeletal muscle, is a significant cause of morbidity following trauma...

Ngày tải lên: 11/08/2014, 08:21

... alpha/ beta chain N terminal domain, ATP synthase alpha/beta chain C terminal domain according to the NCBI Con- served Domain Database website. This indicated tha t the deduced protein was a shrimp ... synthase beta subunit plays a role in the WSSV infection. Conclusions F 1 F 0 -ATP synthase complexes play a central role in the synthesis of ATP in all living organis...

Ngày tải lên: 12/08/2014, 04:20

... factor binding to the cyclin A promoter was analyzed. Takahashi et al., uti- lizing chromatin immunoprecipitation (ChIP) assays to examine the cyclin A promoter at various stages of the cell cycle, ... activity during the G 0 phase (lanes 5 and 6, respectively). Again, the kinase activ- ity associated with cyclin D2 immunoprecipitated complexes appeared to be lower than the...

Ngày tải lên: 13/08/2014, 13:20

... CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT ... binding loop of cystatin A fulfils the same function as the second binding loops of cystatin B and family 2 cystatins and also what residues of this loop in...

Ngày tải lên: 17/03/2014, 10:20

... may in uence the shape and volume of the acyl binding pocket and thereby alter the binding mode and affinity of the enzyme for PAA and derivatives thereof, while maintaining the hydrophobicity of ... The bF24rv mutagenic primer was 5¢-ATAAGTATACGCAG GCGCATACCAGCC AAACTGCGGGCCATTTAC-3¢ and the bF57rv mutagenic primer was 5¢-GGAAATC ACACCATTATGACCA AAAACCAGCCCGGGATA GGC-3¢....

Ngày tải lên: 17/03/2014, 23:20

... (antisense); in the second mutant, Cys239 was exchanged for Ala using the primers 5ÂCGTGACTGT ACTCCACATCgcTGGTAAGGTTAACGC (sense) and 5ÂGCGTTAACCTTACCAgcGATGTGGAGTACAGTC ACG (antisense). The mutated bases ... zinc. XANES spectra of wild-type and mutants As shown in the following, the interpretation of the EXAFS of the mutant enzymes is confirmed by a comparative analy...

Ngày tải lên: 17/03/2014, 23:20

... Taiwan; 3 Department of Pharmacy and Pharmacology, The University of Bath, UK Deacetoxycephalosporin C synthase (DAOCS) catalyses the oxidative ring expansion of penicillin N, the committed step in the ... proposed roles for these residues in binding the carboxylate linked to the nucleus of penicillin N (Arg160 and Arg162) and the carboxylate of the a- amino- ad...

Ngày tải lên: 18/03/2014, 01:20

... scores, the use of heat-inactivated Lactobacillus GG was associated with adverse gastrointestinal symptoms and further study enrollment was thus halted. Another study by Kirjavainen et al suggested ... composition of gut microbiota of allergic infants. a target of bifidobacterial therapy at wean- ing? Gut 2002, 51(1):51-5. 8. Kirjavainen PV, et al.: Characterizing the compositio...

Ngày tải lên: 08/08/2014, 21:20

... func- tional activity of a glucocorticoid-regulated inflammatory cyclooxygenase. Proc Natl Acad Sci USA 1992, 89:4888-4892. 7. Raskin JB: Gastrointestinal effects of nonsteroidal anti-inflam- matory therapy. ... manage acute pain. Moreover, whereas the use of these drugs in the management of acute pain is typically short term (a few days to two weeks), their continuous usage...

Ngày tải lên: 09/08/2014, 01:21