Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot

Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot

Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot

... not for citation purposes) Respiratory Research Open Access Research The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model Mar a del Mar Garc a- Suárez* 1 , ... In this study, we examined the role of PLY in mediating lung damage in experimental acute bacterial pneumonia induced by S. pneumoniae D39 ser...

Ngày tải lên: 12/08/2014, 16:20

10 350 0
Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot

Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot

... have a high oxidative enzyme activity, high capillary density and increased numbers of mitochondria; in contrast fast- twitch fibres have high glycolytic enzyme activity, low capillary density and ... Messina - messinaa@svhm.org.au * Corresponding author Abstract Background: Ischaemia reperfusion (IR) injury of skeletal muscle, is a significant cause of morbidity following trauma...

Ngày tải lên: 11/08/2014, 08:21

7 400 0
Báo cáo y học: "The role of F1 ATP synthase beta subunit in WSSV infection in the shrimp, Litopenaeus vannamei" potx

Báo cáo y học: "The role of F1 ATP synthase beta subunit in WSSV infection in the shrimp, Litopenaeus vannamei" potx

... alpha/ beta chain N terminal domain, ATP synthase alpha/beta chain C terminal domain according to the NCBI Con- served Domain Database website. This indicated tha t the deduced protein was a shrimp ... synthase beta subunit plays a role in the WSSV infection. Conclusions F 1 F 0 -ATP synthase complexes play a central role in the synthesis of ATP in all living organis...

Ngày tải lên: 12/08/2014, 04:20

9 364 0
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx

Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx

... factor binding to the cyclin A promoter was analyzed. Takahashi et al., uti- lizing chromatin immunoprecipitation (ChIP) assays to examine the cyclin A promoter at various stages of the cell cycle, ... activity during the G 0 phase (lanes 5 and 6, respectively). Again, the kinase activ- ity associated with cyclin D2 immunoprecipitated complexes appeared to be lower than the...

Ngày tải lên: 13/08/2014, 13:20

17 299 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT ... binding loop of cystatin A fulfils the same function as the second binding loops of cystatin B and family 2 cystatins and also what residues of this loop in...

Ngày tải lên: 17/03/2014, 10:20

10 533 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

... may in uence the shape and volume of the acyl binding pocket and thereby alter the binding mode and affinity of the enzyme for PAA and derivatives thereof, while maintaining the hydrophobicity of ... The bF24rv mutagenic primer was 5¢-ATAAGTATACGCAG GCGCATACCAGCC AAACTGCGGGCCATTTAC-3¢ and the bF57rv mutagenic primer was 5¢-GGAAATC ACACCATTATGACCA AAAACCAGCCCGGGATA GGC-3¢....

Ngày tải lên: 17/03/2014, 23:20

8 562 0
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc

Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc

... (antisense); in the second mutant, Cys239 was exchanged for Ala using the primers 5ÂCGTGACTGT ACTCCACATCgcTGGTAAGGTTAACGC (sense) and 5ÂGCGTTAACCTTACCAgcGATGTGGAGTACAGTC ACG (antisense). The mutated bases ... zinc. XANES spectra of wild-type and mutants As shown in the following, the interpretation of the EXAFS of the mutant enzymes is confirmed by a comparative analy...

Ngày tải lên: 17/03/2014, 23:20

7 465 0
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx

Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx

... Taiwan; 3 Department of Pharmacy and Pharmacology, The University of Bath, UK Deacetoxycephalosporin C synthase (DAOCS) catalyses the oxidative ring expansion of penicillin N, the committed step in the ... proposed roles for these residues in binding the carboxylate linked to the nucleus of penicillin N (Arg160 and Arg162) and the carboxylate of the a- amino- ad...

Ngày tải lên: 18/03/2014, 01:20

5 463 0
Báo cáo y học: "The role of Probiotics in allergic diseases" pptx

Báo cáo y học: "The role of Probiotics in allergic diseases" pptx

... scores, the use of heat-inactivated Lactobacillus GG was associated with adverse gastrointestinal symptoms and further study enrollment was thus halted. Another study by Kirjavainen et al suggested ... composition of gut microbiota of allergic infants. a target of bifidobacterial therapy at wean- ing? Gut 2002, 51(1):51-5. 8. Kirjavainen PV, et al.: Characterizing the compositio...

Ngày tải lên: 08/08/2014, 21:20

7 561 0
Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc

Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc

... func- tional activity of a glucocorticoid-regulated inflammatory cyclooxygenase. Proc Natl Acad Sci USA 1992, 89:4888-4892. 7. Raskin JB: Gastrointestinal effects of nonsteroidal anti-inflam- matory therapy. ... manage acute pain. Moreover, whereas the use of these drugs in the management of acute pain is typically short term (a few days to two weeks), their continuous usage...

Ngày tải lên: 09/08/2014, 01:21

3 476 0
w