Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

... fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG GCCGGCTCCCAAGCTCC 92.03 S1 rs3918396 G /A 0.09 0.09 fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGAATCCCCGCAGACCATGACAC CCTGCTGGCCATGCTCCTCAGC ... 12 (page number not for citation purposes) Respiratory Research Open Access Research The role of polymorphisms in ADAM33, a disintegrin and metalloprotease...

Ngày tải lên: 12/08/2014, 16:20

12 355 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT ... binding loop of cystatin A fulfils the same function as the second binding loops of cystatin B and family 2 cystatins and also what residues of this loop...

Ngày tải lên: 17/03/2014, 10:20

10 533 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

... may in uence the shape and volume of the acyl binding pocket and thereby alter the binding mode and affinity of the enzyme for PAA and derivatives thereof, while maintaining the hydrophobicity of ... The bF24rv mutagenic primer was 5¢-ATAAGTATACGCAG GCGCATACCAGCC AAACTGCGGGCCATTTAC-3¢ and the bF57rv mutagenic primer was 5¢-GGAAATC ACACCATTATGACCA AAAACCAGCCCGGGAT...

Ngày tải lên: 17/03/2014, 23:20

8 562 0
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc

Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc

... activity and in distinct changes in the zinc ligands. In the His237 fi Ala and Cys239 fi Ala mutants, coenzyme M also seemed to bind efficiently by ligation to zinc indicating that some aspects of ... zinc. XANES spectra of wild-type and mutants As shown in the following, the interpretation of the EXAFS of the mutant enzymes is confirmed by a comparative analysi...

Ngày tải lên: 17/03/2014, 23:20

7 465 0
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx

Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx

... proposed roles for these residues in binding the carboxylate linked to the nucleus of penicillin N (Arg160 and Arg162) and the carboxylate of the a- amino- adipoyl side-chain (Arg266). The results ... Taiwan; 3 Department of Pharmacy and Pharmacology, The University of Bath, UK Deacetoxycephalosporin C synthase (DAOCS) catalyses the oxidative ring expansion of...

Ngày tải lên: 18/03/2014, 01:20

5 463 0
Báo cáo y học: "The role of Probiotics in allergic diseases" pptx

Báo cáo y học: "The role of Probiotics in allergic diseases" pptx

... scores, the use of heat-inactivated Lactobacillus GG was associated with adverse gastrointestinal symptoms and further study enrollment was thus halted. Another study by Kirjavainen et al suggested ... composition of gut microbiota of allergic infants. a target of bifidobacterial therapy at wean- ing? Gut 2002, 51(1):51-5. 8. Kirjavainen PV, et al.: Characterizing the composit...

Ngày tải lên: 08/08/2014, 21:20

7 561 0
Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc

Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc

... func- tional activity of a glucocorticoid-regulated inflammatory cyclooxygenase. Proc Natl Acad Sci USA 1992, 89:4888-4892. 7. Raskin JB: Gastrointestinal effects of nonsteroidal anti-inflam- matory therapy. ... manage acute pain. Moreover, whereas the use of these drugs in the management of acute pain is typically short term (a few days to two weeks), their continuous usag...

Ngày tải lên: 09/08/2014, 01:21

3 476 0
Báo cáo y học: "The role of hypoxia and HIF-dependent signalling events in rheumatoid arthritis" ppt

Báo cáo y học: "The role of hypoxia and HIF-dependent signalling events in rheumatoid arthritis" ppt

... of α-subunits, and two transactivating domains, namely the amino-terminal transactivating domain and the carboxyl- terminal transactivating domain (C-TAD). The C-TAD has been shown to interact with co-activators ... activating angiogenesis, hypoxia may regulate many other features that are important in RA, such as cell trafficking and matrix degradation. An understanding of...

Ngày tải lên: 09/08/2014, 01:22

9 500 0
Báo cáo y học: "The role of osteoprotegerin in arthritis" ppsx

Báo cáo y học: "The role of osteoprotegerin in arthritis" ppsx

... Weichselbaum in the Archives for Pathology, Anatomy, Physiology and Clinical Medicine in 1878. (c) Title of the manuscript, meaning The finer changes of joint cartilage in fungous synovitis and caries ... Nagashima M, Yamamoto M, Nishijima T, Katsumata S, Yoshino S: Bone resorption and inflammatory inhibition effi- cacy of intermittent cyclical etidronate therapy in r...

Ngày tải lên: 09/08/2014, 01:23

7 344 0
Báo cáo y học: "The role of statins as potential targets for bone formation" pptx

Báo cáo y học: "The role of statins as potential targets for bone formation" pptx

... 3- hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reduc- tase enzyme. These include naturally occurring lovastatin, chemically modified simvastatin and pravastatin [1–3] and the synthetically derived atorvastatin, ... Comparison, structure and organization of bone and other mineralized tissues and the mechanism of calcifi- cation. In: Handbook of physiology, endocrinolog...

Ngày tải lên: 09/08/2014, 03:24

4 392 0
Từ khóa:
w