Báo cáo y học: "Infliximab in ankylosing spondylitis: alone or in combination with methotrexate? A pharmacokinetic comparative study" ppt
... this article as: Mulleman et al .: Infliximab in ankylosing spondylitis: alone or i n combination with meth o trexate? A ph a rmacokinetic comparative study. Ar thritis R esea rch & Therapy ... concentration between baseline and week 18 (AUC 0-18 ). Clinical and laboratory evaluations were performed at each visit. The Bath Ankylosing Spondylitis Disease Activity Inde...
Ngày tải lên: 12/08/2014, 15:23
... of the manuscript. DL, AC and RC undertook sensorimotor assessment and data analysis. MD performed all clinical evaluations. All authors have read and concur with the final manuscript. They also accept ... purposes) Chiropractic & Osteopathy Open Access Case report Rehabilitation program for traumatic chronic cervical pain associated with unsteadiness: a single case study Danik Laf...
Ngày tải lên: 13/08/2014, 14:20
... antibody; AS = ankylosing spondylitis; ATTRACT = Anti-TNF Trial in Rheumatoid Arthritis with Comcomitant Therapy; BASDAI = Bath Ankylosing Spondylitis Disease Activity Index; BASFI = Bath Ankylosing ... drugs Nonsteroidal anti-inflammatory drugs (NSAIDs) and intra- articular coriticosteroids are accepted, often-used treat- ments for AS [13]. NSAIDs are taken, with varying efficacy...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Therapy of ankylosing spondylitis and other spondyloarthritides: α established medical treatment, anti-TNF-α therapy and other novel approaches" pdf
... antinuclear antibody; AS = ankylosing spondylitis; ATTRACT = Anti-TNF Trial in Rheumatoid Arthritis with Comcomitant Therapy; BASDAI = Bath Ankylosing Spondylitis Disease Activity Index; BASFI ... D, Bellamy N, Calin A, Dougados M, Khan MA, van der Linden S: Preliminary core sets for endpoints in ankylosing spondylitis. Assessments in Ankylosing Spondylitis Working Group. J R...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"
... mg naringin Group 5: Advantra Z ® with 1,000 mg hesperidin and 600 mg naringin After remaining seated and resting for 45 min., participants completed a second self report rating scale. After ... P, Chaudhuri A, et al. Orange juice or fructose intake does not induce oxidative and inflammatory response. Diabetes Care 2007; 30: 1406-1411. 13. Ghanim H, Sai CL, Upadhyay M, et al....
Ngày tải lên: 25/10/2012, 11:04
Báo cáo y học: "Individual and occupational risk factors for knee osteoarthritis: results of a case-control study in Germany" pdf
... transformed into categorical variables for better representation. A further reason for the transformation into categorical variables was the fact that the metric parameters only rarely showed a ... mentioned above. Symptomatic knee OA and smoking The factor of smoking (here measured in package-years) was negatively associated with symptomatic knee OA in women (smoking >20 package...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: "Membrane transporters and protein traffic networks differentially affecting metal tolerance: a genomic phenotyping study in yeas" potx
... 5'-(CGCGGACCGTTAACTGATATCACCATGAGACATG)-3' SMF2 Forward 5'-(CGCGGTCCGCTACGTAGCCACCATGACGTCCCAAGAATATGAACC)-3' SMF2 Reverse 5'-(CGCGGACCGTTAGAGGTGTACTTCTTTGCCCG)-3' SMP1 Forward 5'-(CTCGGTCCGCCACCATGGGTAGAAGAAAAATTGAAATTGAACC)-3' SMP1 ... Forward 5'-(CTCGGTCCGCCACCATGTTTTACCCATATAACTATAGTAAC)-3' NRG1 Reverse 5'-(CTCGGACCGTTATTGTCCCTTTTTCAA...
Ngày tải lên: 14/08/2014, 08:21
Báo cáo y học: "Protein, iron, and meat consumption and risk for rheumatoid arthritis: a prospective cohort study" pps
... RA, rather than until the date of RA diagnosis. We also performed lagged analyses such that the dietary intakes associated with RA cases were assessed at least 4 years before the date of diagnosis. ... well as for the same variables adjusted for in all the multivariate models. d All P values for trend were calculated with median intake of each nutrient in each quintile as a continu...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: " Primary hepatic lymphoma presenting as fulminant hepatic failure with hyperferritinemia: a case report" ppt
... hepatitis B, C and Epstein-Barr have been implicated. Signs and symptoms can mimic a variety of infectious and inflammatory disorders delaying the diag- nosis. A preliminary diagnosis of AOSD was ... weight loss, myalgias and arthralgias. She had mild epigastric dis- comfort with nausea and vomiting. Dalteparin and warfa- rin were started for a recently diagnosed pulmonary Published:...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: "Acute atomoxetine treatment of younger and older children with ADHD: A meta-analysis of tolerability and efficacy" ppsx
... attention-deficit/hyperactivity disorder; ADHD- RS: ADHD Rating Scale-IV; AE: adverse event; ANCOVA: analysis of covariance; ANOVA: analysis of variance; ATX: atomoxetine; CGI-ADHD-S: Clinical Global Impression of ... weight, vital signs, corrected QT interval, and laboratory parameters, treatment difference within each age category was assessed using an ANOVA model with a treatment term....
Ngày tải lên: 13/08/2014, 18:21