Báo cáo y học: "The incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter stud" pptx

Báo cáo y học: "The incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter stud" pptx

Báo cáo y học: "The incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter stud" pptx

... 12:R226 http://arthritis-research.com/content/12/6/R226 Page 9 of 9 RESEARCH ARTICLE Open Access The incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter ... on data obtained from Scandinavian and North American populations) [36]. Table 13 Overall estimation of fragility fractures...

Ngày tải lên: 12/08/2014, 15:22

9 311 0
Báo cáo y học: " The relationship between hip abductor muscle strength and iliotibial band tightness in individuals with low back pain" potx

Báo cáo y học: " The relationship between hip abductor muscle strength and iliotibial band tightness in individuals with low back pain" potx

... conception and design, acquisition of data, analysis and interpretation of data and have been involved in preparing the manuscript. Both authors read and approved the final manuscript. Competing interests The ... Abbreviations ITB: Iliotibial Band; LBP: Low Back Pain; TFL: Tensor Fascia Lata Author details 1 Department of Physical Therapy, Universi ty of Social Welfare and...

Ngày tải lên: 13/08/2014, 14:20

5 375 0
Báo cáo y học: " The incidence of relative adrenal insufficiency in patients with septic shock after the administration of etomidate" pot

Báo cáo y học: " The incidence of relative adrenal insufficiency in patients with septic shock after the administration of etomidate" pot

... shock after etomidate administration. We hypothesised that the administration of etomidate increases the incidence of relative adrenal insufficiency in patients with septic shock. Materials and ... cosyntropin stimulation test, or if they had an adrenal or pituitary disorder. The Mayo Foundation Institutional Review Board approved the study, and a waiver of informed consent wa...

Ngày tải lên: 13/08/2014, 01:20

3 266 1
Báo cáo y học: "The incidence of multidrug and full class resistance in HIV-1 infected patients is decreasing over time (2001–2006) in Portugal" potx

Báo cáo y học: "The incidence of multidrug and full class resistance in HIV-1 infected patients is decreasing over time (2001–2006) in Portugal" potx

... Dinis, Ana Mineiro, Isabel Batista, José Vera, Ana Galiano, Luís Tavares, Sofia Pinheiro, Maria João Águas, Júlio Botas, José Poças, Ana Paula Brito, Carlos Santos, Domitília Faria, Ana Paula ... interpretation of the genotypic resistance information. In particular, the decline in resistance can be partially explained by the fact that in the early years of 2000, treatment initiat...

Ngày tải lên: 13/08/2014, 06:20

8 292 1
Báo cáo y học: "The incidence of sub-optimal sedation in the ICU: a systematic review" ppsx

Báo cáo y học: "The incidence of sub-optimal sedation in the ICU: a systematic review" ppsx

... retrospective assessment of impact on sedative and analgesic requirements, levels of sedation and analgesia, and ventilatory and hemodynamic parameters. Pharmacotherapy 2007, 27:351-359. 43. Payen JF, Chanques ... TS, Ramsay P, Lapinlampi TP, Sarkela MO, Viertio-Oja HE, Merilainen PT: An assessment of the validity of spectral entropy as a measure of sedation state in mec...

Ngày tải lên: 13/08/2014, 20:21

14 436 0
Báo cáo y học: "The impact of HLA-DRB1 genes on extra-articular disease manifestations in rheumatoid arthritis" doc

Báo cáo y học: "The impact of HLA-DRB1 genes on extra-articular disease manifestations in rheumatoid arthritis" doc

... 149 extra-articular rheumatoid arthritis (ExRA) and 163 non-ExRA patients. b Information available from 120 ExRA and 151 non-ExRA patients. ANA, antinuclear antibody; RA, rheumatoid arthritis; ... duration of RA ± 5 years. DNA samples were available from 86 ExRA cases and 85 controls for HLA typing. Another cohort of patients was recruited from a prospective study of ext...

Ngày tải lên: 09/08/2014, 07:20

8 352 0
Báo cáo y học: "The effect of tight glycaemic control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis" pptx

Báo cáo y học: "The effect of tight glycaemic control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis" pptx

... resulting in increased gluconeogenesis and glycogenolysis [3]. Uncontrolled hyperglycaemia can lead to: hypokalaemia, hyponatraemia, arrhythmias and an increased risk of ischemic brain injury [4]. ... cardiopulmonary bypass with insulin may initiate postoperative hypoglycaemia. Anesth Anal 1999, 89:1091-1095. 13. Ghandi GY, Nuttall GA, Abel MD, et al: Intensive intraoperative insulin...

Ngày tải lên: 10/08/2014, 09:23

10 851 0
Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot

Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot

... Para- cetamol and Piritramid intravenously as needed. After the surgery, the boy complained of a relapsing upper abdominal pain. Laboratory parameters showed increased markers for cholestasis. After an ... and t hey had muscle hypotrophy, signs of chronic hypoxia and chronic hepatitis B. The 10-year-old had malaria quar- tana, and his older brother had terminal renal insuffi- ci...

Ngày tải lên: 11/08/2014, 12:20

6 438 0
Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx

Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx

... GCCTCATTTTCCTCTGGATTCC SP-B TGGGAGCCGATGACCTATG CAAGAGTGTGAGGACATCGTCCACATCC GCCTCCTTGGCCATCTTGT SP-C CGGGCAAGAAGCTGCTTCT CCACACCGCAGGGACAAACCCT CCACACCGCAGGGACAAACCCT SP-D ACACAGGCTGGTGGACAGTTG CCTCTCCACGCTCTGCCGCGT ... contributions YI carried out all human and rat ATII cells studies. YI and RJM participated in the design of the study and data analysis. All authors have read and...

Ngày tải lên: 12/08/2014, 11:23

13 257 0
Báo cáo y học: " The role of secretory leukocyte proteinase inhibitor and elafin (elastase-specific inhibitor/skin-derived antileukoprotease) as alarm antiproteinases in inflammatory lung disease" ppt

Báo cáo y học: " The role of secretory leukocyte proteinase inhibitor and elafin (elastase-specific inhibitor/skin-derived antileukoprotease) as alarm antiproteinases in inflammatory lung disease" ppt

... recently been termed the trappin family [2 • ]. Elafin can be divided into two domains, the carboxy-terminal domain containing the antiproteinase active site and the amino-terminal domain containing ... molecules of the collectin family [such as the surfactant proteins A (SP -A) ] and defensins (indicated by 1). In addition, SLPI and elafin have a role in modulating inflammati...

Ngày tải lên: 12/08/2014, 18:20

6 188 0
Từ khóa:
w