Báo cáo y học: "Characterization of a panel of six β2-adrenergic receptor antibodies by indirect immunofluorescence microscopy" doc

Báo cáo y học: "Characterization of a panel of six β2-adrenergic receptor antibodies by indirect immunofluorescence microscopy" doc

Báo cáo y học: "Characterization of a panel of six β2-adrenergic receptor antibodies by indirect immunofluorescence microscopy" doc

... citation purposes) Respiratory Research Open Access Research Characterization of a panel of six β 2 -adrenergic receptor antibodies by indirect immunofluorescence microscopy Yulia A Koryakina 1,2,3 , ... Corporation N-terminal domain of human β 2 AR - - Ab13300 Abcam, Inc. N-terminal domain of human β 2 AR - - Ab-Bethyl Bethyl Laboratories, Inc. Last 15 aa of C-ter...
Ngày tải lên : 12/08/2014, 15:21
  • 9
  • 195
  • 0
Báo cáo y học: "Rheumatoid cachexia: a complication of rheumatoid arthritis moves into the 21st century" potx

Báo cáo y học: "Rheumatoid cachexia: a complication of rheumatoid arthritis moves into the 21st century" potx

... loss of body fat-free mass is often accompanied by increased fat mass and stable body weight. Rheumatoid cachexia may affect up to two-thirds of all patients with RA [3,4]. Elkan and colleagues, ... issue of Arthritis Research & Therapy includes an important article on rheumatoid cachexia by Elkan and colleagues [1] demonstrating that cachexia remains common in rheumatoid arthri...
Ngày tải lên : 09/08/2014, 14:20
  • 2
  • 257
  • 0
Báo cáo y học: "Pain as a symptom of peripheral nerve sheath tumors: clinical significance and future therapeutic directions" potx

Báo cáo y học: "Pain as a symptom of peripheral nerve sheath tumors: clinical significance and future therapeutic directions" potx

... 505 Parnassus Ave, San Francisco, California, USA and 2 Department of Medicine, University of California at San Francisco, 505 Parnassus Ave, San Francisco, California, USA Email: Michael E ... manuscript. References 1. Ogose A, Hotta T, Morita T, Yamamura S, Hosaka N, Kobayashi H, Hirata Y: Tumors of peripheral nerves: correlation of symp- toms, clinical signs, imaging features, a...
Ngày tải lên : 10/08/2014, 10:20
  • 5
  • 377
  • 0
Báo cáo y học: "Staffing level: a determinant of late-onset ventilator-associated pneumonial" pdf

Báo cáo y học: "Staffing level: a determinant of late-onset ventilator-associated pneumonial" pdf

... first anal- ysis included all first episodes of VAP; the second analysis included only early-onset VAP; and the last analysis included only late-onset VAP. When failure was early-onset VAP, patients ... a late-onset VAP were excluded and vice versa. Early-late and late-onset VAP were investigated in a univariate and multivariate model, and only variables associated with a P < 0.2 i...
Ngày tải lên : 13/08/2014, 08:20
  • 7
  • 217
  • 0
Báo cáo y học: "Staffing level: a determinant of late-onset ventilator-associated pneumonia" potx

Báo cáo y học: "Staffing level: a determinant of late-onset ventilator-associated pneumonia" potx

... at risk cannot start before initiation of mechanical ventilation, and precisely how long a patient remains at risk after extubation is unknown. We agree that 5 days is an arbitrary cut-off value, ... significantly associated with health care associated infections [2-4], but we lack data on the process of nursing care that may very well inform us as to why this staffing association exist...
Ngày tải lên : 13/08/2014, 08:20
  • 3
  • 161
  • 0
Báo cáo y học: "Delirium as a predictor of sepsis in post-coronary artery bypass grafting patients: a retrospective cohort study" docx

Báo cáo y học: "Delirium as a predictor of sepsis in post-coronary artery bypass grafting patients: a retrospective cohort study" docx

... Wistbacka JO, Nissinen J, Sintonen H, Huhtala H, Tarkka MR: Postoperative delirium and health related quality of life after coronary artery bypass grafting. Scandinavian Cardiovascular Journal ... statistical analyst for the division of Cardiac Surgery at Dalhousie University. RCA is the Rudy Falk Clinician-Scientist and Assistant Professor in Surgery and Physiology at the University of...
Ngày tải lên : 13/08/2014, 21:21
  • 6
  • 305
  • 0
Báo cáo y học: " Microfinance as a method of facilitating research in emergency medicine" ppsx

Báo cáo y học: " Microfinance as a method of facilitating research in emergency medicine" ppsx

... 4200 Slagelse, Denmark † Contributed equally Full list of author information is available at the end of the article Hallas et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... is properly cited. Commentary Microfinance as a method of facilitating research in emergency medicine Peter Hallas* † , Mikkel Brabrand † and Lars Folkestad* Abstract Microgrants...
Ngày tải lên : 13/08/2014, 23:21
  • 3
  • 245
  • 0
Báo cáo y học: " The reticulons: a family of proteins with diverse function" pptx

Báo cáo y học: " The reticulons: a family of proteins with diverse function" pptx

... 160:224-235. 36. Iwahashi J, Kawasaki I, Kohara Y, Gengyo-Ando K, Mitani S, Ohshima Y, Hamada N, Hara K, Kashiwagi T, Toyoda T: Caenorhabditis elegans reticulon interacts with RME-1 during embryogene- sis. ... factor betaPIX. J Cell Biochem 2006, 99:1203-1215. 41. Wakana Y, Koyama S, Nakajima K, Hatsuzawa K, Nagahama M, Tani K, Hauri HP, Melancon P, Tagaya M: Reticulon 3 is involved in mem...
Ngày tải lên : 14/08/2014, 08:20
  • 10
  • 295
  • 0
Báo cáo y học: "Diarrhea as a cause of mortality in a mouse model of infectious colitis" ppt

Báo cáo y học: "Diarrhea as a cause of mortality in a mouse model of infectious colitis" ppt

... identified by microarray analysis. Gastroenterology 2002, 122:1467-1482. 72. Bekku S, Mochizuki H, Takayama E, Shinomiya N, Fukamachi H, Ichi- nose M, Tadakuma T, Yamamoto T: Carbonic anhydrase I and ... fileAdditional data file 11Variably expressed genes as a function of time (delta eta analysis)Variably expressed genes as a function of time (delta eta analysis).Click here for file...
Ngày tải lên : 14/08/2014, 20:22
  • 19
  • 300
  • 0
Báo cáo y học: "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust" docx

Báo cáo y học: "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust" docx

... UUAUUGGACCAAA dse A- CCGCAACUA UUAUUGGACCAAA der A- CCGCAACUA UUAUUGGACCAAA dya A- CCGCAACUA UUAUUGGACCAAA dan A- CCGCAACUA UUAUUGGACCAAA dpe A- CCGCAACUA UUAUUGGACCAAA dps A- CCGCAACUA UUAUUGGACCAAA dwi AACUA ... CGCGCCGCACGAUGUAUCCAUAUUAAGCAGAGCCACGUGUAUCGGCGAACGCAUACUCGAGAAGGGCGCGCUCGAGACGAAGUGAAAAGACAUCCCGGUCAAGUACGAAAAAGUUGACGUU 5' 3' CGCGCCGCACGAUGUAUCCAUAUUAAGCAGAGCCACG...
Ngày tải lên : 14/08/2014, 21:20
  • 18
  • 364
  • 0

Xem thêm

Từ khóa: