Báo cáo y học: " IL-13 induces a bronchial epithelial phenotype that is profibrotic" ppt
Báo cáo y học: " IL-13 induces a bronchial epithelial phenotype that is profibrotic" ppt
... reported as mean ± SD and InStat 2.01 for Macintosh software package was used for all analysis. Data were analyzed using one-way analysis of variance (ANOVA) with Student Newman Keuls post-test analysis for ... periods. Immunofluorescence microscopy At day 22 (i.e. after 14 days IL-13 treatment and 1 day withdrawal of IL-13 containing media) and day 28 (i.e. 14 day treatment and 7 day wit...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
... 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3'. The resulting amplicons were then combined in a second ... vRNA across each individual infection (YA, YB and YC) for Rounds 2 and 3 was determined. Statistical significance was calculated using the t-test assuming equal variance with a one-tailed a...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: " ''''Libyan Trial'''': a verdict running counter to scientific evidence" ppt
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: " The reticulons: a family of proteins with diverse function" pptx
... musculus, Danio rerio, Xenopus laevis, Droso- phila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae and many other eukaryotes, but not in archaea or bacteria [1-6]. ... 2007, 8:234 88. Yokota T, Mishra M, Akatsu H, Tani Y, Miyauchi T, Yamamoto T, Kosaka K, Nagai Y, Sawada T, Heese K: Brain site-specific gene expression analysis in Alzheimer’s disease pat...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "To dose or not to dose: that is the (starch) question" potx
... dose. Abbreviations AKI, acute kidney injury; ARF, acute renal failure; HES, hydroxyethyl starch; RIFLE, risk, injury, failure, loss, and end-stage kidney disease. Competing interests The author declares ... with low volume hydroxyethylstarch 130 kDa/0.4 is not associated with acute kidney injury. Crit Care 2010, 14:R40. 2. Sakr Y, Payen D, Reinhart K, Sipmann FS, Zavala E, Bewley J, Ma...
Ngày tải lên: 13/08/2014, 20:21
Báo cáo y học: " Association between nasal shedding and fever that influenza A (H3N2) induces in dogs" potx
... nasal discharg e and coughing) and rectal temperatures were recorded daily for 14 days post-inoculation (DPI), and nasal swab samples for the detection of viral shedding were also collected daily ... South Korea. Animal care and treatment were conducted in accordance with guidelines established by the Green Cross Veterinary Products Institutional Animal Care and Use Committee. Clinical signs...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Canakinumab (ACZ885, a fully human IgG1 anti-IL-1b mAb) induces sustained remission in pediatric patients with cryopyrin-associated periodic syndrome (CAPS)" ppsx
... signs, hematology blood chemistry and urinalysis, and assays for anti-canakinumab antibodies using a binding BIA- core ® assay (Biacore International AB, Rapsgatan 7, 754 50 Uppsala, S weden) [16]. Height and ... 13:R34 http://arthritis-research.com/content/13/1/R34 Page 7 of 10 18. Lachmann HJ, Tannenbaum S, Chakraborty A, Preiss R, Hawkins PN: Pharmacokine tics ( PK) of canakinumab (ACZ8...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: "Hypervolemia induces and potentiates lung damage after recruitment maneuver in a model of sepsis-induced acute lung injury" pps
... 5'-CTT CAG AGG CAG GAA ACA GG-3'); and glyceraldehyde-3-phos- phate dehydrogenase (GAPDH; sense 5'-GGT GAA GGT CGG TGTG AAC- 3' and antisense 5'-CGT TGA TGG CAA CAA TGT C-3'). ... TGG ACC ACA AGG ACA C-3' and antisense 5'-TGG ACC CAT TTC ACC TTT C-3'); caspase-3 (sense 5'-GGC CGA CTT CCT GTA TGC-3' and antisense 5'-GCG CAA AGT GAC TG...
Ngày tải lên: 13/08/2014, 20:22
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... were calculated by logistic regression. Probability that was the same or below 0.01 was accepted as statistically significant. Results A total of 67 610 emergency calls were analyzed, and of these, ... review board. Data in this study The selected old municipality-based centers had compu- ter-based statistical data on EMD assignments and ambu- lance feedback, which made a comparison on...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"
... comprised more than 95% of esophageal malignancies [48]. In our meta-analysis, we had wanted to analysis the associa- tion between these two gene polymorphisms and risk of esophageal cancer according ... it is reasonable to hypothesize that the Arg72Pro poly- morphism with reduced activity of p53 may play more important role in esophageal cancer risk. In the present meta-analysis on...
Ngày tải lên: 25/10/2012, 11:40