Báo cáo y học: " (R)-albuterol decreases immune responses: role of activated T cells" docx

... TTGTGGAAGGGCTCATGACC (FW), TCTTCT- GGGTGGCAGTGATG (RE) (NM008084), IL-2: GTCAACAGCGCACCCACTT (FW), TGCTTCCGCTGTA- GAGCTTG (RE) (NM008366), IL-6: TTCCATCCAGTT- GCCTTCTTG (FW), GAAGGCCGTGGTTGTCACC (RE) (NM008355), ... IL-13: AATCTGTCTGCAGGTGGGCT (FW), GGCTTCTCACTTTCATTGGCAC (RE) (NM031168), IFN- γ: AGGTGTCACAACTGCTGCCA (FW), ACACCCGAAT- GAGCTGCTCT (RE) (NM008337). Direct detection of the PCR...

Ngày tải lên: 12/08/2014, 15:21

Ngày tải lên: 12/08/2014, 18:21

... in this context little is known about the role of the mucosal immune system. To our knowledge, this is the first comparative study with a large cohort of SIV-infected RM of Indian origin effectively ... aimed to investigate if and how the mucosal immune system contributes to the control of v iral replication, and we performed detailed analyses of three distinct mucosal sites e...

Ngày tải lên: 13/08/2014, 01:20

... with their pets need not represent any risk for infection with Toxoplasma gondii. Cats are the definitive host of T. gondii; they are the only animals that pass oocysts in their feces. They ... from pet cats [1]. A Toxoplasma-infected cat that is shedding the parasite in its feces (approximately 2% of the cat population at any given time) contaminates the litter box. If the cat is...

Ngày tải lên: 03/11/2012, 11:06

... interaction in the rheumatoid synovium. The essential factor in this situation appears to be the T cell-monocyte interaction to the extent that T- cell isolation renders the cells sensitive to ... that this might be overcome by the combination of locally administrated glucocorticoids with monocyte-targeted therapies rather than T- cell apoptosis-inducing therapies. Competing interests T...

Ngày tải lên: 09/08/2014, 01:22

... the development of anti-tumour necrosis factor (TNF) therapies for patients with rheumatoid arthritis. The anti-TNF approach not only introduced another effective treatment option for rheumatoid ... crucial first to process accurately the vast amount of raw data generated, but then also to translate purely descriptive array data into information on potentially important and functional bio...

Ngày tải lên: 09/08/2014, 08:22

... shown). Formation of CFU Functionality of the cultured CPCs was determined in different ways, that is, CFU potential, migratory capacity and cluster for- mation capacity on Matrigel. After seven days of ... important role in the repair of vascular damage that underlies the development of atherosclerosis. The objective of this study was to determine the number and functionality...

Ngày tải lên: 09/08/2014, 10:20

... dependent on the complex cell-cell interaction in the rheumatoid synovium. The essential factor in this situation appears to be the T cell-monocyte interaction to the extent that T- cell isolation ... therapies. Competing interests The authors declare that they have no competing interests. Authors' contributions DM performed the immunohistochemistry and flow cytometry experiments, par...

Ngày tải lên: 09/08/2014, 13:22

... phenotype in vitro was identified by investigators in John Hamilton’s laboratory and may represent an immature monocyte that has the ability to replicate in target tissues [7]. Circulating monocytes ... cells. The authors state that functional analysis of proliferation may provide a better tool for identification of specific monocyte subsets since it is difficult to know if specific patte...

Ngày tải lên: 09/08/2014, 14:21

... hits in the D. pulex genome of >90% over >80% of their length at the nucleotide level, indicating they may be capable of current activity. a Elements flanked by TTAA nucleotides, but with ... promoted indicate that recombination has significant effects on TE dynamics, most notably via the redistribution of copies due to independent assortment. Whether or not sex influences rates...

Ngày tải lên: 09/08/2014, 20:21