Báo cáo y học: " Pioglitazone is as effective as dexamethasone in a cockroach allergen-induced murine model of asthma" doc
Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc
... Nakamura S, Moriguchi A, Morishita R, Aoki M, Yo Y, Hayashi S,Nakano N, Katsuya T, Nakata S, Takami S, et al.: A novel vascularmodulator, hepatocyte growth factor (HGF), as a potent index of ... 2001,1:136-143.18. Yaekashiwa M, Nakayama S, Ohnuma K, Sakai T, Abe T, Satoh K,Matsumoto K, Nakamura T, Takahashi T, Nukiwa T: Simultaneousor delayed administration of hepatocyte growth factor equallyrepresses ... were as follows:1. IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCGand CAGTGATGAGGACTTGGACTCATTCATGGTGC.2. TGF-β1, TGGACCGCAACAACGCCATCTATGA-GAAAACC and TGGAGCTGAAGCAATAGTTGGTATC-CAGGGCT.3. β-actin,...
- 7
- 399
- 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... community-based study usingdemographic data generated over a 50 year period from3102 individuals born in alternating seasons of relativefood availability and low infectious diseases burden (har-vest/low ... using insecticide-treated bed nets and targeted chemoprophylaxis in a rural area of TheGambia, west Africa. 1. A review of the epidemiology and control of malaria in The Gambia, west Africa. Trans ... likely to die frominfectious diseases as young adults[1,2]. By splitting theyear in half, seasonal fluctuations are taken into account,ensuring that periods of typical hungry/high infectionand...
- 11
- 527
- 0
Báo cáo y học: " Pioglitazone is as effective as dexamethasone in a cockroach allergen-induced murine model of asthma" doc
... CAACAACGACGAGAAGTTCTACTTATCCAAAGG 3'Muc5-acforward 5' CCAGCACCATCTCTACAACCC 3'reverse 5' GCAAAGCTCCTGTTTGCACTC 3'Probe 5' CCCAAACTATCTCAACCTCAGGGTCCACC 3'MIP3-αforward ... citation purposes)Respiratory ResearchOpen AccessResearch Pioglitazone is as effective as dexamethasone in a cockroach allergen-induced murine model of asthmaVenkata R Narala1, Rajesh Ranga1, ... peak airway resist-ance was recorded as a measure of airway hyperreactivity.Enzyme-linked immunosorbent assays (ELISAs)The levels of cytokine and chemokine proteins in wholelung homogenate...
- 10
- 273
- 0
Báo cáo y học: "Giantin is the major Golgi autoantigen in human anti-Golgi complex sera" pptx
... putative AGA sera and normal control sera wereobtained from the laboratory serum bank and AdvancedDiagnostics Laboratory at the University of Calgary,Canada. Some AGA sera were also provided by Drs ... nuclear and cytoplasmicstaining unrelated to the Golgi complex as demonstrated by (d) lack of costaining with rabbit antigiantin antibody.autoantigens (Fig. 3b). For example, giantin clearly hasmore ... complex is localized in the perinuclearregion of most mammalian cells and is characterized bystacks of membrane-bound cisternae, as well as by func-tionally distinct trans-Golgi and cis-Golgi...
- 8
- 342
- 0
Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx
... analysis of data. HAJinvolved in acquisition of data, analysis of data. SJK involved in acquisition of data, analysis of data and participating in comprehensive discussion. WSKinvolved in analysis ... analysis of data and participating in comprehensive discussion.HWL involved in acquisition of data, analysis of data. HSE involved in acquisition of data, analysis of data and participating in ... comprehensivediscussion. SHJ involved in acquisition of data, analysis of data andparticipating in comprehensive discussion. JSP involved in acquisition of data, analysis of data and participating in comprehensive...
- 9
- 312
- 0
Báo cáo y học: "Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD" ppsx
... manufacturer’sinstructionsusingBSA as standards (Thermo Scientific, Rockford, IL).SIRT1 deacetylase activity assaySIRT1 activity was assayed using a deacetylase colori-metric activity assay kit acc ... AccessEmphysema is associated with increasedinflammation in lungs of atherosclerosis-pronemice by cigarette smoke: implications in comorbidities of COPDGnanapragasam Arunachalam, Isaac K Sundar, Jae-woong ... and atherogenesis. It is also known that a decline in lung function is associated with increased cardiovascular comorbidity in smokers. The mechanism of this cardiopulmonary dual riskby cigarette...
- 10
- 371
- 0
Báo cáo y học: "Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD" potx
... manufacturer’sinstructionsusingBSA as standards (Thermo Scientific, Rockford, IL).SIRT1 deacetylase activity assaySIRT1 activity was assayed using a deacetylase colori-metric activity assay ... analysisData were presented as means ± SEM. Statistical analy-sis of significance was ca lculated using one-way analysis of variance followed by post hoc test for multigroupcomparisons using ... the inflammatory cell influxwas associated with proinflammatory cytokine release in ApoE-/-mice, the levels of proinflammatory mediators,such as MCP-1 and KC, which can recruit macrophagesand...
- 10
- 487
- 0
Báo cáo y học: "Seropositivity is associated with insulin resistance in patients with early inflammatory polyarthritis: results from the Norfolk" pot
... testing using both HOMA-IR as a continuous variable and IR as a binary variable may be an issue. Whilst HOMA-IR may be considered more statistically valid, the use of IR as a binary variable is ... serological status (RF and ACPA) and insulin resistance measured as HOMA-IR. This association persists after adjustment for classic cardiovascular risk factors and other IP-related factors. As far as ... coordinated and supervised data collection, analysis and manuscript writing. AY was the laboratory lead in analysing the serum insulin levels. DB is the Clinical Manager in charge of patient recruitment,...
- 20
- 308
- 0
Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx
... holoenzyme was also able to supporttranscriptional activation (at least fivefold, as measured with a Phosphoimager) by the mammalian Gal4-AP2 transcrip-tional activator protein (lane 11), indicating ... Factors involved in specifictranscription by human RNA polymerase II: analysis by a rapidand quantitative in vitro assay. Proc. Natl Acad. Sci. USA 82,4394–4398.11. Spahr, H., Khorosjutina, ... collected and dialysed againstdialysis buffer. TEV protease was eliminated from theeluates for passage onto a Ni-NTA–agarose column. TheRNAPII holoenzyme was further purified on a heparin–Sepharose...
- 12
- 412
- 0
Báo cáo y học: "Comparative responses to nasal allergen challenge in allergic rhinitic subjects with or without asthma" potx
... after 1and 4 days of nasal allergen challenges are presented in Table 2. There was a significant increase in the percen-tage of eosinophils in nasal lavage after 4 days of nasalallergen challenges ... pathophysiology of allergic rhinitis or its relationshipswith asthma.Trial registration: ClinicalTrials.gov NCT01286129BackgroundAsthma and rhinitis are two airway inflammatory dis-eases that often ... different parts: a baseline visit, a control day (nasal challenge with 0.9% saline) and 4consecutive days of nasal allergen challenge (days 1-4).Rousseau et al. Allergy, Asthma & Clinical Immunology...
- 8
- 444
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật