... Nakamura S, Moriguchi A, Morishita R, Aoki M, Yo Y, Hayashi S, Nakano N, Katsuya T, Nakata S, Takami S, et al.: A novel vascular modulator, hepatocyte growth factor (HGF), as a potent index of ... 2001, 1:136-143. 18. Yaekashiwa M, Nakayama S, Ohnuma K, Sakai T, Abe T, Satoh K, Matsumoto K, Nakamura T, Takahashi T, Nukiwa T: Simultaneous or delayed administration of hepatocyte gro...
Ngày tải lên: 09/08/2014, 08:22
... community-based study using demographic data generated over a 50 year period from 3102 individuals born in alternating seasons of relative food availability and low infectious diseases burden (har- vest/low ... using insecticide- treated bed nets and targeted chemoprophylaxis in a rural area of The Gambia, west Africa. 1. A review of the epidemiology and control of malaria...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Pioglitazone is as effective as dexamethasone in a cockroach allergen-induced murine model of asthma" doc
... CAACAACGACGAGAAGTTCTACTTATCCAAAG G 3' Muc5-ac forward 5' CCAGCACCATCTCTACAACCC 3' reverse 5' GCAAAGCTCCTGTTTGCACTC 3' Probe 5' CCCAAACTATCTCAACCTCAGGGTCCACC 3' MIP3- α forward ... citation purposes) Respiratory Research Open Access Research Pioglitazone is as effective as dexamethasone in a cockroach allergen-induced murine model of...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: "Giantin is the major Golgi autoantigen in human anti-Golgi complex sera" pptx
... putative AGA sera and normal control sera were obtained from the laboratory serum bank and Advanced Diagnostics Laboratory at the University of Calgary, Canada. Some AGA sera were also provided by Drs ... nuclear and cytoplasmic staining unrelated to the Golgi complex as demonstrated by (d) lack of costaining with rabbit antigiantin antibody. autoantigens (Fig. 3b). For example, giantin...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx
... analysis of data. HAJ involved in acquisition of data, analysis of data. SJK involved in acquisition of data, analysis of data and participating in comprehensive discussion. WSK involved in analysis ... analysis of data and participating in comprehensive discussion. HWL involved in acquisition of data, analysis of data. HSE involved in acquisition of data, anal...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD" ppsx
... manufacturer’sinstructionsusing BSA as standards (Thermo Scientific, Rockford, IL). SIRT1 deacetylase activity assay SIRT1 activity was assayed using a deacetylase colori- metric activity assay kit acc ... Access Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD Gnanapragasam Aruna...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD" potx
... manufacturer’sinstructionsusing BSA as standards (Thermo Scientific, Rockford, IL). SIRT1 deacetylase activity assay SIRT1 activity was assayed using a deacetylase colori- metric activity assay ... analysis Data were presented as means ± SEM. Statistical analy- sis of significance was ca lculated using one-way analysis of variance followed by post hoc test for multigroup comparisons...
Ngày tải lên: 11/08/2014, 06:22
Báo cáo y học: "Seropositivity is associated with insulin resistance in patients with early inflammatory polyarthritis: results from the Norfolk" pot
... testing using both HOMA-IR as a continuous variable and IR as a binary variable may be an issue. Whilst HOMA-IR may be considered more statistically valid, the use of IR as a binary variable is ... serological status (RF and ACPA) and insulin resistance measured as HOMA-IR. This association persists after adjustment for classic cardiovascular risk factors and other IP-re...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx
... holoenzyme was also able to support transcriptional activation (at least fivefold, as measured with a Phosphoimager) by the mammalian Gal4-AP2 transcrip- tional activator protein (lane 11), indicating ... Factors involved in specific transcription by human RNA polymerase II: analysis by a rapid and quantitative in vitro assay. Proc. Natl Acad. Sci. USA 82, 4394–4398. 11. Spahr, H., Kh...
Ngày tải lên: 30/03/2014, 14:20
Báo cáo y học: "Comparative responses to nasal allergen challenge in allergic rhinitic subjects with or without asthma" potx
... after 1 and 4 days of nasal allergen challenges are presented in Table 2. There was a significant increase in the percen- tage of eosinophils in nasal lavage after 4 days of nasal allergen challenges ... pathophysiology of allergic rhinitis or its relationships with asthma. Trial registration: ClinicalTrials.gov NCT01286129 Background Asthma and rhinitis are two airway inflamm...
Ngày tải lên: 08/08/2014, 21:20