Báo cáo y học: " Chlamydophila pneumoniae induces a sustaine

Báo cáo y học: " Chlamydophila pneumoniae induces a sustained airway hyperresponsiveness and inflammation in mice" potx

... respiratory infections and asthma exacerbations has been evaluated both for viral agents [1-3], and non-viral respiratory pathogens, such as Mycoplasma pneumoniae and Chlamydophila pneumoniae [4- 8]. Involvement ... [12,35-37]. Atypical pathogen persistent infection may participate in airway inflammation. Chlamydial infection activates a cytokine response including basic fi...

Ngày tải lên : 12/08/2014, 15:21

9
283
0

Báo cáo y học: "Oxidized phospholipids reduce ventilator-induced vascular leak and inflammation in vivo" pot

... cellular contraction, and paracellu- lar gap formation (arrows). OxPAPC enhanced monolayer integrity and peripheral actin cytoskeletal rearrangement in ECs exposed to 18% CS alone and dramatically ... for immunofluorescence staining as previously described [21,33]. Rho and Rac activation assays Rho and Rac activation assays were performed using com- mercially available assay kit...

Ngày tải lên : 13/08/2014, 10:20

13
248
0

Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx

... Efficacy of human papillomavirus (HPV)-16/18 AS04-adjuvanted vaccine against cervical infection and precancer caused by oncogenic HPV types (PATRICIA): final analysis of a double-blind, randomised ... this article as: Bhagawati-Prasad et al.: CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis. Journal of Immune Based Therapies and...

Ngày tải lên : 11/08/2014, 08:21

3
245
0

Báo cáo y học: " IL-13 induces a bronchial epithelial phenotype that is profibrotic" ppt

... reported as mean ± SD and InStat 2.01 for Macintosh software package was used for all analysis. Data were analyzed using one-way analysis of variance (ANOVA) with Student Newman Keuls post-test analysis for ... Khashayar R, Wong HH, Ferrando R, Wu R, Hyde DM, Hotchkiss JA, Zhang Y, Novikov A, Dolganov G, Fahy JV: Mild and moderate asthma is associated with airway goblet cell hyperplas...

Ngày tải lên : 12/08/2014, 15:21

12
198
0

Báo cáo y học: "IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis κ synovial fibroblasts via NF-κB- and PI3-kinase/Akt-dependent pathways" doc

... Hata K, Andoh A, Shimada M, Fujino S, Bamba S, Araki Y, Okuno T, Fujiyama Y, Bamba T: IL-17 stimulates inflammatory responses via NF- κκ B and MAP kinase pathway in human colonic myofibroblasts. ... revealed that both synovial fibroblasts and T cells participate in the perpetuation of joint inflammation as dynamic partners in a mutual activation feedback, via secretion of cyt...

Ngày tải lên : 09/08/2014, 01:23

9
411
0

Báo cáo y học: " Is interleukin-1 a good target for therapeutic intervention in intervertebral disc degeneration: lessons from the osteoarthritic experience" pdf

... they act in the same way in degenerated and herniated IVDs? Do they act in the same time period? Are both cytokines involved in pain generation? What is the role of IL-1α? These data suggest that ... greatly to our understanding of disc remodeling in degenerative IVD, notably the role of pro-inflammatory cytokines. They compare the expression of IL-1β and TNFα as well as their m...

Ngày tải lên : 09/08/2014, 10:21

2
412
0

Báo cáo y học: "Candida albicans induces cyclo-oxygenase 2 expression and prostaglandin E2 production in synovial fibroblasts through an extracellular-regulated kinase 1/2 dependent pathway" pps

... may induce joint inflammation and destruction, the detailed inflammatory responses and associated mechanisms are largely unknown. The present study was undertaken to establish a model to examine ... C. albicans infection of synovial fibroblasts in vitro results in upregulation of cyclo-oxygenase 2 and prostaglandin E2 by mechanisms that may involve activation of extracellular- r...

Ngày tải lên : 09/08/2014, 14:20

9
403
0

Báo cáo y học: "Organic farmers use of wild food plants and fungi in a hilly area in Styria (Austria)." docx

... 6:17 http://www.ethnobiomed.com/content/6/1/17 Page 6 of 14 Rosaceae (6 species), followed by Brassicaceae and Aster- aceae (3 species each), then Lamiaceae, Plantaginaceae, Boletaceae, Agaricaceae, Russulaceae and Ramariaceae (2 species ... by frequency and percentages. The use value (UV) of plants, first developed by Phillips and Gen- try [37] and adjusted by Tardío and Pardo-de...

Ngày tải lên : 10/08/2014, 09:21

14
414
0

Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps

... Suto Y, Yasuda K, Shiiya N, Murashita T, Kawasaki M, Imamura M, Takigami K, Sasaki S, Matsui Y, Sakuma M: Stented elephant trunk procedure for an extensive aneurysm involving distal aortic arch and descending ... sodium pentothal, sevofluorane, fentanyl and muscle re laxant. Invasive monitoring included the use of right radial and left radial arterial lines, a pulmonary artery cathe...

Ngày tải lên : 10/08/2014, 09:21

5
571
0

Báo cáo y học: " Vaccine based on a ubiquitous cysteinyl protease and streptococcal pyrogenic exotoxin A protects against Streptococcus pyogenes sepsis and toxic shock" pptx

... amplified DNA fragment by using the oligonucleotide primer 5' CTCG CAA GAG GTA CAT ATG CAA CAA GAC 3' to produce a unique NdeI site, and 5' GCA GTA GGT AAG CTT GCC AAA AGC 3' to ... following oligonucleotide primers: 1. SpeA forward primer, including NdeI site: 5' GATATACATATGCAACAAGACCCCGATCCAAGCC 3' 2. SpeA reverse primer, with SpeB overlap: 5' GAGATTT...

Ngày tải lên : 11/08/2014, 10:23

8
326
0