Báo cáo y học: "Inverse association of plasma IL-13 and inflammatory chemokines with lung function impairment in stable COPD: a cross-sectional cohort study" doc
... Research Open Access Research Inverse association of plasma IL-13 and inflammatory chemokines with lung function impairment in stable COPD: a cross-sectional cohort study Janet S Lee* 1 , Matthew ... in a COPD cohort is characterized by cytokines implicated in inflammatory cell recruitment and airway remodeling. Plasma concentrations of IL-13...
Ngày tải lên: 12/08/2014, 15:21
... (South Africa) and Kampala (Uganda), where the study was conducted for their Table 2 ANOVA showing differences of having and not-having a natural mentor on mental health by orphan-types Orphan-types No parents ... persons aged below 18 used. Local interviewers are Luganda (Ug anda) and Setswana/Afrikaans (South Africa) speak- ing research collaborators. The interviewer-administered...
Ngày tải lên: 11/08/2014, 16:22
... data on associations between total meat and type of meat intake and the risk of type 2 DM are inconsistent and limited [3]. Total meat intake was associated with a higher risk of diabetes in ... 5 years and provided information on daily activity such as walking, stair climbing, cycling, household activities and daily commuting to and from work (walking and cycl...
Ngày tải lên: 31/10/2012, 16:49
Báo cáo y học: "The association of psychological stress and health related quality of life among patients with stroke and hypertension in Gaza Strip" pps
... 1 Department of Psychiatry, School of Medicine, James Cook University, Australia, 2 Department of Psychiatry and Psychotherapy, University of Munster, Germany and 3 Islamic University, Gaza, Palestinian ... below in the manuscript. The study was approved by the Ministry of Health in Gaza and the local ethical committee in Gaza Strip. Inclusion and exclusion criteri...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease" potx
... HE, Ingram JA, Norton HJ, Hanley EN Jr: Senescence in cells of the aging and degenerating intervertebral disc: immu- nolocalization of senescence-associated beta-galactosidase in human and sand ... millilitre and a final alginate concentration of 1.2%. The alginate beads were then incubated in combinations of medium supple- mented with or without serum and glucose a...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Sequence complementarity of U2 snRNA and U2A'''' intron predicts intron function" pptx
... >UGGCAGUACCUCCGGGCACGGUGCACCUCCCCCGGGAGGAAUGUGGCGUGGUGAAAGGAGAGAAGGAAGGCGGGGCGGUG Dr >UUGCAGUACUUCCGGGAACGGUGCACCCCCUAAUGAAGUUAACAAUAGAAUCCU Dr2 >UUGCAGUACUUCCGGGAACGGUGCACCCCCUAAUCAAGUUAAUGGAAGAUUAAAA ... >GCACCAUAUAUUAAAUUGAUUUUUGGAAUAGGGAGAUGGAAUAGGGGCUUGCUCCGUCCACUCCACGCAUCGACCCGGUA> Fr >GGACUAUAUAUUAAAUGCAUUUUUGCAGACAGGAGCUGAAACAGGAGCUUGCUCCAUUCACUCCACGCAUUGGCCCAGUA&...
Ngày tải lên: 14/08/2014, 14:21
báo cáo hóa học:" Increased vulnerability of rural children on antiretroviral therapy attending public health facilities in South Africa: a retrospective cohort study" docx
... hospitals due to the availability of paediatricians and related support and a shortage of clinicians at the primary healthcare level. Lack of pharmacy staff at decentralized facilities is also a barrier, ... providing rural ART in sub-Saharan Afr ica include a lack of health personnel, lack of diagnostic facilities, difficulty and expense transporting medication to cli...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo y học: "Biochemical markers of bone turnover and their association with bone marrow lesions" docx
... for all of the biomarker assays in 150 participants. Upon merging the biomarker assay data and MRI data, complete data (both com- plete biomarker and MRI data) were available for analysis in 144. ... standard deviation increase in the LnNTx, and with a small partial R 2 of 3.05. We also evaluated 144 participants in the Framingham Osteoarthritis Study, whose mean age was...
Ngày tải lên: 09/08/2014, 13:21
Báo cáo y học: "Negative association of the chemokine receptor CCR5 d32 polymorphism with systemic inflammatory response, extra-articular symptoms and joint erosion in rheumatoid arthritis" ppsx
... years of disease duration was analyzed (n = 158). In addition, in 118 patients, a radiograph taken after more than 10 years of disease dura- tion was available and was analyzed separately. In addition, ... hand and feet radiographs of the patients. The presence of extra-articular manifestations of the disease was judged by retrospective chart review and by anal- ysis...
Ngày tải lên: 09/08/2014, 14:21
Báo cáo y học: "Unusual association of ST-T abnormalities, myocarditis and cardiomyopathy with H1N1 influenza in pregnancy: two case reports and review of the literature" pps
... T, Ayabe T, Kawagoe J, Matsuda J, Ishikawa T, Unoki T, Takenaga M, Fukunaga T, Nakagawa S, Koiwaya Y, Eto T: Clinical manifestations of influenza a myocarditis during the influenza epidemic of ... lack k nowledge regarding the safety and impor- tance of influenza vaccination during pregnancy. Mis- informed or inadequately informed health care workers may represent a barrier to in...
Ngày tải lên: 10/08/2014, 23:22