Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt

Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt

Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt

... and reliable tool for measuring heart rate in reindeer, also in natural conditions. heart rate; measuring technique; method; individual coding; reindeer; behaviour; circadian. Acta vet. scand. 2002, ... food intake in reindeer (Rangifer tarandus tarandus). Acta Physiol. Scand. 2000, 170, 145-151. Moen AN: Seasonal changes in heart rates, activity, metabolism, and...

Ngày tải lên: 12/08/2014, 15:20

10 239 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs ... line A and cell line B. The trainin g set was the only one used for model calculations (PCA, genetic algorithm and LDA). Data reduction by principal component analysis (PC...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... recovered differentially based on varying stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis ... protein is required for an intact binding interface [3,4]. As a protein mutagenesis strategy, phage-display offers a number of important advantages. The technology fo...

Ngày tải lên: 19/02/2014, 12:20

7 502 0
Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc

Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc

... NEGRA export for- mat. CLAUS Report 98, Universitat des Saarlandes, Computerlinguistik, Saarbriicken, Germany. Erhard Hinrichs, Julia Bartels, Yasuhiro Kawata, Valia Kordoni, and Heike Telljohann. ... platform and operating system chosen. 3.1 Initialising a Treebank The input format of treebanks fsq can cope with is the NEGRA export format (Brants, 1997). This format is designed fo...

Ngày tải lên: 22/02/2014, 02:20

8 375 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... of 2-pyrimidinone containing DNA as a MTase inhibitor. 2-pyrmidinone incorporation in DNA sequences may also serve as a specific probe for studying discrimination contacts formed by proteins and functional groups ... 5204–5210. 28. Sharath, A. N., Weinhold, E. & Bhagwat, A. S. (2000) Reviving a dead enzyme: cytosine deaminations promoted by an inactive DNA methyltransferase...

Ngày tải lên: 07/03/2014, 15:20

9 437 0
Báo cáo khoa học: "Machine Aided Error-Correction Environment for Korean Morphological Analysis and Part-of-Speech Tagging" pptx

Báo cáo khoa học: "Machine Aided Error-Correction Environment for Korean Morphological Analysis and Part-of-Speech Tagging" pptx

... Kim, and H. Rim. 1996. " ;A Korean Transformation-based Part-of-Speech Tagger with Lexical information of mistagged Eo- jeol". Korea-China Joint Symposium on Ori- ental Language Computing, ... to the augmented case, such as '~(saram)/ncn+da'un/ncpa', '2 ,-7, (hag'gyo)/ncn+da'un/ncpa'. Correction rule can apply to the many kinds of word p...

Ngày tải lên: 08/03/2014, 05:21

5 306 0
Báo cáo khoa học nông nghiệp " Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces " pdf

Báo cáo khoa học nông nghiệp " Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces " pdf

... use a portion of their course material the SOFRI training was done over one day and was called an “Introduction to Internal Auditing”. The Internal Auditor training has been continued and its ... presentation has subsequently been used as a training tool for the farmers and packers in the area. During the PowerPoint presentations, care was taken to emphasise the standards...

Ngày tải lên: 21/06/2014, 05:20

10 598 0
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt

Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt

... contain a PAS domain. Therefore, in the case of A. thaliana,thePASandPAC motifs are inseparable, indicating that the annotation of these proteins as containing only PAS or PAC motifs is questionable. ... Ponting and Aravind ([3]) observed that conserved motifs representative of PAS domains were ubiquitous in archaea, bacteria and eucarya, and that many PAS containing proteins wer...

Ngày tải lên: 19/02/2014, 12:20

11 592 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... L. lactis ald gene as follows. A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified. The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, re...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Báo cáo khoa học: "Creative Language Retrieval: A Robust Hybrid of Information Retrieval and Linguistic Creativity" pot

Báo cáo khoa học: "Creative Language Retrieval: A Robust Hybrid of Information Retrieval and Linguistic Creativity" pot

... one can be “as rich as a fat king”, something can be “as rich and enticing as a chocolate truffle”, a chocolate brownie”, a chocolate fruitcake”, and even a chocolate king”. The Jigsaw Bard ... articulate a need for information, creative IR queries articulate a need for expressions to convey the same meaning in a fresh or unusual way. A query and a matching phrase...

Ngày tải lên: 07/03/2014, 22:20

10 384 0
Từ khóa:
w