Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf
Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf
... LH, Arnason T, Cracknell V: Elimination of mange mites Sar- coptes scabiei var. suis from two naturally infested Danish sow herds using a single injection regime with doramectin. Acta vet. scand. ... 75-84. Acta vet. scand. vol. 43 no. 2, 2002 Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo khoa học: Structure of the atrial natriuretic peptide receptor extracellular domain in the unbound and hormone-bound states by single-particle electron microscopy ppt
... volume. Because of the availability of apoECD and ANP–ECD crystal structures, we also performed reference-based refinement (eman) as a means of evaluating agreement of the single- particle data with ... intrinsic guanylate cyclase (GCase) activity. The ANP receptor occurs as a homodimer of a single- transmembrane polypeptide, each containing an extracellular ANP- binding do...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Mechanism of the reaction catalyzed by dehydroascorbate reductase from spinach chloroplasts doc
... Kinetic parameters of wild-type and mutant forms of DHAR from spinach chloroplasts. Values of k cat were calculated using a molecular mass of 24 kDa. Values of k cat and K m are given as means ±SD ... (Osaka, Japan). 4-Fluoro- 7-sulfamoylbenzofurazan was obtained from Dojin (Kuma- moto, Japan). Other chemicals and reagents were of the highest purity commercially available....
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Structures of type B ribose 5-phosphate isomerase from Trypanosoma cruzi shed light on the determinants of sugar specificity in the structural family ppt
... The integration of macromolecular diffraction data. Acta Crystallogr D Biol Crystallogr 62, 48–57. 30 Evans P (2006) Scaling and assessment of data quality. Acta Crystallogr D Biol Crystallogr 62, ... derivatization [13]. Isomeriza- tion of this 6-carbon sugar could not be detected, even when it was added at a concentration of 30 mm. The same preparation of TcRpiB had a k cat o...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Evolution of the teleostean zona pellucida gene inferred from the egg envelope protein genes of the Japanese eel, Anguilla japonica potx
... GGAAAGGAACAGTGGGTTAGT Reverse: ATCAGCCGCCAAAGTGCCAGG ezpcb Forward: GGGAAGGAACGGTGGATTGAG Reverse: CTGCATTCAGAGGGCTAATGG ezpcc Forward: GGAACTCAACGGTGGATTAGT Reverse: CTCTACCACCAAGTGTTGGCT ezpcd Forward: TTCCTACCTTCAAAGCATGGG Reverse: ... diethanolamine and Table 2. Primer sequences specific for each eZP gene. Gene Primer (5¢-to3¢) ezpb Forward: GCAAAGAAGGTCAATTGCTCC Reverse: TACGACAGCCAATGCCA...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Characterization of the flavin association in hexose oxidase from Chondrus crispus pot
... oxidase (EC 1.1.3.5) from Hansenula polymorpha was found to exhibit a dual covalent association of FAD with His79 via an 8a- histidyl linkage as well as a covalent association between Cys138 and ... S, Brabrand, Denmark 2 Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, Denmark Hexose oxidase (HOX) catalyses the oxidation of a variety of hexose sugars wit...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Characterization of L-aspartate oxidase and quinolinate synthase from Bacillus subtilis potx
... 89 NADA_SYNY3 MFTAVAPPQETLP RDLVGAIQSLKKELNAVILAHYYQEAAIQDIADYLG DSLGLSQQAASTD ADVIVFAGVHFMAETAKILNPHK 85 NADA_SYNEC MFTAVAPPQETLP RDLVGAIQSLKKELNAVILAHYYQEAAIQDIADYLG DSLGLSQQAASTD ADVIVFAGVHFMAETAKILNPHK ... O06596). NADA_ATHAL: from Arabidopsis thaliana (GenBank accession number NP_199832). NADA_OSATI: from Oryza sativa (GenBank accession number ABA_97161). I. Marinoni et al. NadA an...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo khoa học: Inhibition of Hsp90 function delays and impairs recovery from heat shock ppt
... resulted from a general inhi- bition of the translational machinery. First, there was no overall inhibition or activation of translation rate as assessed by trichloroacetic acid (TCA) precipitation of ... volume of 4 · Lae- mmli-formula SDS ⁄ PAGE buffer was added. Protein con- centration was determined by Bradford assay (Bio-Rad) and equal lg samples analyzed on standard Laemmli...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: "Effects of canopy opening on height and diameter growth in naturally regenerated beech seedlings" pps
... input data required by the model are: • Climatic data: daily potential evapotranspiration and daily rainfall. These data were collected at the INRA weather station at Amance, 20 km east of the ... study site. • A site parameter: maximum extractable soil water (MEW). An average value of 62 mm was chosen for the whole study site. • A stand parameter: leaf area index (LAI). An estimat- e...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo khoa học: " quality of Douglas fir (Pseudotsuga menziesii (Mirb) Franco) from three stands in the Netherlands*" pptx
... logs. The material for the physical-mechanical tests was sawn from the first 2 m of the log from the lower part of all the trees sampled. After sawing, the samples were ... des Pays-Bas. La qualité du bois de douglas (Pseudotsuga menziesii (Mirb) Franco) ayant crû aux Pays-Bas a été étudiée. Un total de 19 arbres a été sélectionné da...
Ngày tải lên: 08/08/2014, 18:21