Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... increase in disability pension risk with increase in absence days/yr. A 10-day increase in ab- sence days per annum (scale score ranging from 0-220 days/yr) yielded an increase in disability pension ... physical work environment variables. The Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with in-...
Ngày tải lên: 26/10/2012, 10:03
Báo cáo y học: "Comparison between partial ulnar and intercostal nerve transfers for reconstructing elbow flexion in patients with upper brachial plexus injurie" pot
... 110° against gravity was regarded as full flexion of the joint. All patients could extend their elbow joints to 0° actively or with the aid of the gravity before the final examination. Obtaining ... bifurcates into a main trunk mainly innervating the intercostal muscles (motor branch) and a lateral bra nch mainly serving the sensation of the anterior chest (sensory branch) alo...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx
... Uemura A, Sugahara K, Nagai H, Murata K, Hasegawa H, Hirakata Y, Tsukasaki K, Yamada Y, Kamihira S: An ATL cell line with an IgH pseudo- rearranged band pattern by southern blotting: a pitfall of ... Nagai H, Murata K, Hasegawa H, Hirakata Y, Takasaki Y, Tsukasaki K, Yamada Y: Proviral status of HTLV-1 integrated into the host genomic DNA of adult T-cell leukemia cells. Cl...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " Albumin dialysis improves hepatic encephalopathy and decreases circulating phenolic aromatic amino acids in patients with alcoholic hepatitis and severe liver failure" doc
... acids; ALT = alanine aminotransferase AP = alkaline phosphatase; AST = aspartate aminotransferase; γGT = gamma-glytamyl transpeptidase; K = potassium; Na = sodium; n.s. = not significant; NCT ... dialysate was maintained at body temperature to avoid cooling of the patient. A continuous infusion of heparin at a dose of 1500 to 4000 IU/hour was used as an anticoagulant when necessa...
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: "The Nordic maintenance care program: what are the indications for maintenance care in patients with low back pain" pot
... proportional use and the proportion of& quot;mainstream” answers was tested using kappa statis- tics. Data were analysed with STATA 8.2 (STATA Cor- poration, 2000, Stata Statistical Software Release ... and educational background has an influence on how many patients receive MC and what type of patients are offered MC. Method The survey A list of actively practising chiropractors...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot
... sputum is a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD. Background Pulmonary vascular remodeling leading to pulmonary hypertension is a characteristic ... Medicine, Osaka City University, 1-4-3, Asahi-machi, Abenoku, Osaka, 545- 8585, Japan Email: Hiroshi Kanazawa* - kanazawa-h@med.osaka-cu.ac.jp; Kazuhisa As...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo y học: "Reduced transforming growth factor-beta signaling in cartilage of old mice: role in impaired repair capacity" ppsx
... Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, et al.: An aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases susceptibility to osteoarthritis. Nat Genet ... TGF-beta signaling capacity, but also that disrupted TGF-beta signaling can indeed induce a distorted repair capacity of cartilage. It has been hypothesized that TGF-beta treatment can...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Wildtype epidermal growth factor receptor (Egfr) is not required for daily locomotor or masking behavior in mice" pps
... Egfr wa2/wa2 mice did exhibit a phase shift resulting in abnormally high daytime activity, as well as abnormally high activity during a three hour light pulse. (B) Abnormal wheel running activity ... during the pulse was calculated as a percentage of the activity at the same time on the previous day. Locomotor activity was recorded and analyzed with ClockLab software (Acti...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Connective tissue growth factor promotes articular damage by increased osteoclastogenesis in patients with rheumatoid arthritis" doc
... 5'-CTAAGTCAT- AGTCCGCCTAGAAGCA-3' (reverse), Cathepsin-K primers as 5'-AGCTGCAATAGCATAATCTGAACC (forward) and 3- CGTTGTTCTTATTTCGAGCCATGA (reverse) and matrix metalloproteinase (MMP)-9 ... CTTGCGAAGCTGACCTGGAA-3' (for- ward) and 5'-AGCTCAAACTTGATAGGCTTGGAGA-3' (reverse), β-actin primers for control primers as 5'-TGGCAC- CCAGCACAATGAA-3' (forward) an...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "Platelet-derived growth factor and transforming growth factor beta synergistically potentiate inflammatory mediator synthesis by fibroblast-like synoviocytes" potx
... fibroblast-like synoviocytes in vitro was studied by quantitative Polymerase Chain Reaction (qPCR), ELISA and multiplex bead cytokine assays. Intracellular signaling pathway activation was determined ... TNF-alpha-induced production of proinflammatory cytokines via inhibition of NF-kappab and PI3 kinase/ Akt signal pathway in human rheumatoid arthritis fibroblast-like synoviocytes...
Ngày tải lên: 12/08/2014, 12:20