Báo cáo y học: " The role of γδ T cells in airway epithelial injury and bronchial responsiveness after chlorine gas exposure in mice" pps

... hyperresponsiveness and exhibit an attenuated inflammatory response. The contri- bution of γδ T cells to epithelial regeneration in the intes- tine is not evident in the airways. Competing interests The author(s) ... inflammatory response to acute epithelial injury and in maintaining and repairing the epithelial barrier [16]. Chen et al. have found that a...

Ngày tải lên: 12/08/2014, 15:20

... phenotypically [27,28]. These studies indicate the existence of an IL-23/IL-17 axis of communication between the innate and adaptive parts of the immune system that might be an interesting target ... 1). Role of IL-17 in T cell immunity and/ or propagation of joint inflammation In arthritis, IL-17 is a pro-inflammatory cytokine thought to contribute to the joint i...

Ngày tải lên: 09/08/2014, 06:22

... purposes) gastrocnemius and the fast-twitch EDL muscles. We also demonstrate that muscle fibre type, and mouse strain independently, determined susceptibility to IR injury. The susceptibility of different ... exhibit different susceptibilities. The relative degree of mast cell mediated injury, within different muscle types, is not known. Methods: In this study we compared su...

Ngày tải lên: 11/08/2014, 08:21

... T reg cells does reflect their more activated phenotype, and their ability to enter inflamed joints makes it possible that they act directly at the site of inflammation. Discussion Our findings ... With this in mind, it could be interesting to investigate whether the accumu- lated T reg cells in patients with arthritis function properly in vivo and whether these patien...

Ngày tải lên: 09/08/2014, 06:22

... motifs, one at the N- and the other at the C- terminus [20]. p21/waf1 (mut) is mutated at the N-terminus and is therefore still able to bind to cyclins through the C-terminus, making this protein ... within the N terminus and the other at the C terminus [20]. p21/waf1 interacts with both cyclins and cdks, in contrast to the INK family CDKI members, which only bind...

Ngày tải lên: 13/08/2014, 13:20

... Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G ... contains three domains resembling family 2 cystatins. Cystatins competitively inhibit the activity of papain- like cysteine proteases by binding to the active site of the latter and...

Ngày tải lên: 17/03/2014, 10:20

... volume of the acyl binding pocket and thereby alter the binding mode and affinity of the enzyme for PAA and derivatives thereof, while maintaining the hydrophobicity of the binding site. To test the ... constants for the deacylation reaction in the active site of the acyl-enzyme have been changed by the bF24A mutation. The rate-limiting step in the syn...

Ngày tải lên: 17/03/2014, 23:20

... finding that both MtaA mutants still bind coenzyme M and exhibit some activity although in both mutants the coordination of zinc differs from the situation in the wild-type enzyme. Apparently, other ... of the thiol group as shown by the release of a proton upon binding of the substrate to the zinc enzyme [21]. MtaA does not share sequence similarity to any of th...

Ngày tải lên: 17/03/2014, 23:20

... consistent with the proposed roles for these residues in binding the carboxylate linked to the nucleus of penicillin N (Arg160 and Arg162) and the carboxylate of the a-amino- adipoyl side-chain ... substrate, and may be a consequence of the higher K m value for this substrate [1,22]. The third type of mutant, represented by arginines 306 and 307, are located i...

Ngày tải lên: 18/03/2014, 01:20

... as the timing of the introduction of the probiotic, Taylor et al administered the probiotic supplement postnatally, while other studies administered probiotics before and after birth. Prenatal supplementation ... in allergic disorders The interest in probiotic therapeutic potential in allergic disorders stemmed from the fact that they have been shown to reduce inflam...

Ngày tải lên: 08/08/2014, 21:20