Báo cáo khoa học: "Plasma Calcium, Inorganic Phosphate and M

Báo cáo khoa học: "Plasma Calcium, Inorganic Phosphate and Magnesium During Hypocalcaemia Induced by a Standardized EDTA Infusion in Cows" docx

... studies. Na 2 EDTA; induce. Acta vet. scand. 2001, 42, 251-260. Acta vet. scand. vol. 42 no. 2, 2001 Plasma Calcium, Inorganic Phosphate and Magnesium During Hypocalcaemia Induced by a Standardized EDTA ... inorganic phosphate and magnesium during hypocalcaemia induced by a standardized EDTA infusion in cows. Acta vet. scand. 2001, 42, 251-26...

Ngày tải lên : 12/08/2014, 15:20

10
250
0

Báo cáo khoa học: "Low dietary inorganic phosphate affects the lung growth of developing mice" pps

... inorganic phosphate, lung Introduction Inorganic phosphate (Pi) is present in bacterial, fungal, plant and animal cells. Pi plays a critical role in diverse cellular functions that are involved ... The antibody against mammalian target of rapamycin (mTOR) was obtained from Cell Signaling (USA). After washing in TBST, the membranes were incubated with a horseradish p...

Ngày tải lên : 07/08/2014, 23:22

9
271
0

báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx

... tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc PCR-RFLP (HaeIII) Leptin receptor gene - Q223R aaactcaacgacactctcctt tgaactgacattagaggtgac PCR-RFLP ... brain areas, such as the hypothalamic arcuate nucleus. In some cells of hypothalamus, leptin and insulin activate both JAK-STAT and PI3K sig...

Ngày tải lên : 10/08/2014, 10:21

9
356
0

Báo cáo khoa học: "Plasma concentrations of cortisol and PGF2α metabolite in Danish sows during mating, and intrauterine and conventional insemination" pps

... mating, and intrauterine and conventional insemination Mattias Norrby* 1 , Mads T Madsen 2 , Charlotte Borg Alexandersen 3 , Hans Kindahl 4 and Andrzej Madej 1 Address: 1 Department of Anatomy, ... included the back pressure test after manipulation of the abdominal area, the area under vulva, the inguinal area and the pelvic area. For intrauterine insemination an insemination cath...

Ngày tải lên : 12/08/2014, 18:22

7
367
0

Tài liệu Báo cáo khoa học: Platelet factor 4 disrupts the intracellular signalling cascade induced by vascular endothelial growth factor by both KDR dependent and independent mechanisms ppt

... the MAP kinase pathway by an intracellular mechanism induced by PF-4 suggests that this chemokine may induce angiostatic activity via a speciﬁc receptor. Recent data have suggested that PF-4 can ... protein kinase A (PKA) may be involved [44]. Indeed, P KA inhibits the MAP k inase pathway by blocking Raf1 activity in many cell systems [45–47]. Moreover, PF-4 increases cAMP level...

Ngày tải lên : 19/02/2014, 16:20

9
400
0

Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot

... ribosomes and unacylated tRNA and how pppGpp synthesis is stimulated. We have isolated a recombinant His-tagged SF by afﬁnity-puriﬁcation and by taking advantage of the natural ability of the protein ... formed by incu- bating TC-ribosomes with T4-mRNA and tRNA Met f for 10 min at 37 °C. tRNA Phe was added and incubation continued for 10 min. SF was added to the reactions a...

Ngày tải lên : 07/03/2014, 16:20

11
446
0

Báo cáo khoa học: Modeling of ATP–ADP steady-state exchange rate mediated by the adenine nucleotide translocase in isolated mitochondria potx

... MgCl 2 ,5mm glutamate, 5 mm malate, 0.5 mgÆmL )1 BSA (fatty acid-free) (pH 7.25), 50 lm diadenosine pentaphosphate (A p 5A) , and 2 lm MgG 5K + salt. Including the adenylate kinase inhibitor A p 5A in the medium ... rate mediated by ANT. Bar graph of ATP–ADP steady-state exchange rate mediated by ANT in the absence (white bar) and presence (gray bar) of 10 l M nigericin. PMF...

Ngày tải lên : 16/03/2014, 00:20

14
444
0

Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

... expression and activity are partly regulated by Jun N-terminal kinases (JNKs) and mitogen activated protein kinases. JNKs phosphorylate the N terminus of the trans- acting domain of Jun, thereby increasing ... Wistar strain weighing 150–170 g were procured from the Animal Facility, Jawaharlal Nehru University, New Delhi, India. Animals were fed water and standard rat chow ad libitum....

Ngày tải lên : 23/03/2014, 20:22

9
449
0

Báo cáo khoa học: "Effect of BL-21 (Wei-Yu) acupoint stimulation on gastric motility following preanesthetic treatment in dogs" docx

... such cases acupuncturist needs chemical restraints which aid in an animal restraint by modifying behavior, reducing stress and eliminating or minimizing pain. But a number of chemical restraints influence ... general anaesthesia with halothane and diazepam on postoperative gastric emptying in man. Acta. Anaesthesiol. Scand. 1984, 28 , 390-392. 3. Albibi, R., McCallum, R. W. Meto...

Ngày tải lên : 07/08/2014, 14:23

6
319
0

Báo cáo khoa học: "Mac-1-mediated Uptake and Killing of Bordetella bronchiseptica by Porcine Alveolar Macrophages" pptx

... internalized viable intracellular bacteria, the incubation time of macrophages with bacteria was extended from 30 min to 1 hr. Macrophage-associated extracellular bacteria were eliminated by adding ... the binding and uptake pattern of B. bronchiseptica at various ratios of bacteria to AM was determined. Linear responses of bacteria binding and uptake were demonstrated in less than...

Ngày tải lên : 07/08/2014, 17:22

9
194
0