Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx
Báo cáo khoa học: "An Object-Oriented Approach to the Design of Dialogue Management Functionality" doc
... current handling instance.
Again, in an actual real-world system these data
might be contained in the database to which the
instance has, from the overall system's
perspective, exclusive access. ... with the goal of finding a handling
instance. If in response to the system's question
'Is that a railway ticket or an airline ticket?' the
us...
Báo cáo y học: "Practical and theoretical barriers to the prevention of accelerated atherosclerosis in systemic lupus erythematosus" docx
... factor
management and barriers to acceptance of these measures must also be studied further.
Keywords: atherosclerosis, cardiac risk factor, coronary artery disease, systemic lupus erythematosus
... Online ISSN 1478-6362)
Abstract
Accelerated atherosclerotic vascular disease (ASVD) is a major cause of death in systemic lupus
erythematosus (SLE). Although many authorities are callin...
Báo cáo y học: " Many LINE1 elements contribute to the transcriptome of human somatic cells" pptx
... TATGATTAAAAAAAAAAAGTACTGTAACCAAAAAAAAAAAA
5 ’ TATAATAAAAAAAATAAAAAATAAAAAACAACTCTCAGAAGCAAAAAAAAAAAA
5 ’ TATAATAAAAAAAAAAGAAGCCAAAAAAAAAAAA
5 ’ TATAATAAAAAAAAAAAATTAAAAAAATAAAAAAAAACATATACCTATTGAAGGAAAAAAAAAAAA
5 ’ TAAAATAATAAAAAAGAAATGAAATATGAAATAAAAAAAAAAAA
LI ... AAATAAAAAACAACTCTCAGAAGC
U35 tag TATAATAAAAAAAATAAATAAATAAATAAAAAATAAAATAAAAAACAACTCTCAGAAGC
chr4 long tag TATAATAAAAAAAATAAA AA...
Báo cáo y học: "An alternative surgical approach to subclavian and innominate stenosis: a case series" ppsx
... innominate graft
was attached to the aorta in a similar fashion to the
proximal coronary anastomosis.
Postoperative magnetic resonance imaging showed a
patent aorto-innominate bypass with good antegrade
flow ... extra-anatomic
bypass reveals that inflow in the donor artery is the key
factor that determines the haemodynamic effects of
extra-anatomic bypass. If the inf...
Báo cáo y học: " Renal cell carcinoma metastasis to the ciliary body responds to proton beam radiotherapy: a case report" pptx
... JOURNAL OF MEDICAL
CASE REPORTS
Renal cell carcinoma metastasis to the ciliary
body responds to proton beam radiotherapy: a
case report
Alasil et al.
Alasil et al. Journal of Medical Case Reports ... photograph delineates the mass-lens adhesions prior to proton beam radiotherapy.
(e) SLE photograph of the right eye after proton radiotherapy shows a significant decrease...
Báo cáo y học: "Severe leukocytoclastic vasculitis secondary to the use of a naproxen and requiring amputation: a case report" ppt
... mainstay therapy
for systemic vasculitides for the initial induction of remis-
sion [9,17]. Cyclophosphamide is a cytotoxic agent that
achieves cytotoxic effects by alkylating DNA of rapidly
proliferating ... secondary to
Type III hypersensitivity can be augmented through the
use of dapsone [19].
Bacteremia caused by E. coli secondary to a urinary
tract infection delayed...
Báo cáo y học: "Perforating eyelid injury extending to the brain stem in a 17-year-old woman: a case report" pot
... the brain cavity, because a wooden
object can appear on a CT scan as a l ucent body with
nearly the same density as air or fat. Thus, a wooden
Figure 1 Photograph of the tip of the umbrella. The ... indicating
minor brain damage.
After the vitreous hemorrhage had cleared, a retinal
break was found superiorly where the intraretinal
hemorrhage had been located, and...
Báo cáo y học: "This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon." ppsx
... reported a non-typical pattern of usual
interstitial pneumonia (UIP), mainly due to the the absence of a caudocranial
gradient. However, the main localization of the abnormalities was in the upper ... predominance and sparing of adjacent parenchyma lung
marks this disease as a entity .In routine chest X-rays it is quite common to
report bilateral apical thicke...
Báo cáo y học: " Does respiratory health contribute to the effects of long-term air pollution exposure on cardiovascular mortality?" pot
... limitation to the study
and may result into a bias of our risk ratio estimates.
Indeed, assuming a smaller conversion factor for the rural
area, for instance 0.65, which means greater fraction of
coarse ... including indicators of respiratory health into the
regression analysis. Furthermore, no interaction between air pollution and respiratory health on cardiovascular
mort...
Báo cáo sinh học: "An automated stochastic approach to the identification of the protein specificity determinants and functional subfamilies" pot
... we always assume 5Å to be the cutoff
for two atoms to be contacting each other, and co ntact-
ing residues are defined by the co ntact of their nearest
atoms.
Results
Performance of SDPclust in ... the
LacI family applying the Mann-Whitney test to distances
of the predicted SDPs to the functional site of the pro-
tein compared to all amin o acid resudues of...
Từ khóa: