Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx

... current handling instance. Again, in an actual real-world system these data might be contained in the database to which the instance has, from the overall system's perspective, exclusive access. ... with the goal of finding a handling instance. If in response to the system's question 'Is that a railway ticket or an airline ticket?' the us...

Ngày tải lên: 24/03/2014, 03:20

... factor management and barriers to acceptance of these measures must also be studied further. Keywords: atherosclerosis, cardiac risk factor, coronary artery disease, systemic lupus erythematosus ... Online ISSN 1478-6362) Abstract Accelerated atherosclerotic vascular disease (ASVD) is a major cause of death in systemic lupus erythematosus (SLE). Although many authorities are callin...

Ngày tải lên: 09/08/2014, 01:22

... TATGATTAAAAAAAAAAAGTACTGTAACCAAAAAAAAAAAA 5 ’ TATAATAAAAAAAATAAAAAATAAAAAACAACTCTCAGAAGCAAAAAAAAAAAA 5 ’ TATAATAAAAAAAAAAGAAGCCAAAAAAAAAAAA 5 ’ TATAATAAAAAAAAAAAATTAAAAAAATAAAAAAAAACATATACCTATTGAAGGAAAAAAAAAAAA 5 ’ TAAAATAATAAAAAAGAAATGAAATATGAAATAAAAAAAAAAAA LI ... AAATAAAAAACAACTCTCAGAAGC U35 tag TATAATAAAAAAAATAAATAAATAAATAAAAAATAAAATAAAAAACAACTCTCAGAAGC chr4 long tag TATAATAAAAAAAATAAA AA...

Ngày tải lên: 09/08/2014, 20:20

... innominate graft was attached to the aorta in a similar fashion to the proximal coronary anastomosis. Postoperative magnetic resonance imaging showed a patent aorto-innominate bypass with good antegrade flow ... extra-anatomic bypass reveals that inflow in the donor artery is the key factor that determines the haemodynamic effects of extra-anatomic bypass. If the inf...

Ngày tải lên: 10/08/2014, 09:22

... JOURNAL OF MEDICAL CASE REPORTS Renal cell carcinoma metastasis to the ciliary body responds to proton beam radiotherapy: a case report Alasil et al. Alasil et al. Journal of Medical Case Reports ... photograph delineates the mass-lens adhesions prior to proton beam radiotherapy. (e) SLE photograph of the right eye after proton radiotherapy shows a significant decrease...

Ngày tải lên: 10/08/2014, 23:22

... mainstay therapy for systemic vasculitides for the initial induction of remis- sion [9,17]. Cyclophosphamide is a cytotoxic agent that achieves cytotoxic effects by alkylating DNA of rapidly proliferating ... secondary to Type III hypersensitivity can be augmented through the use of dapsone [19]. Bacteremia caused by E. coli secondary to a urinary tract infection delayed...

Ngày tải lên: 11/08/2014, 11:20

... the brain cavity, because a wooden object can appear on a CT scan as a l ucent body with nearly the same density as air or fat. Thus, a wooden Figure 1 Photograph of the tip of the umbrella. The ... indicating minor brain damage. After the vitreous hemorrhage had cleared, a retinal break was found superiorly where the intraretinal hemorrhage had been located, and...

Ngày tải lên: 11/08/2014, 14:21

... reported a non-typical pattern of usual interstitial pneumonia (UIP), mainly due to the the absence of a caudocranial gradient. However, the main localization of the abnormalities was in the upper ... predominance and sparing of adjacent parenchyma lung marks this disease as a entity .In routine chest X-rays it is quite common to report bilateral apical thicke...

Ngày tải lên: 12/08/2014, 14:20

... limitation to the study and may result into a bias of our risk ratio estimates. Indeed, assuming a smaller conversion factor for the rural area, for instance 0.65, which means greater fraction of coarse ... including indicators of respiratory health into the regression analysis. Furthermore, no interaction between air pollution and respiratory health on cardiovascular mort...

Ngày tải lên: 12/08/2014, 15:20

... we always assume 5Å to be the cutoff for two atoms to be contacting each other, and co ntact- ing residues are defined by the co ntact of their nearest atoms. Results Performance of SDPclust in ... the LacI family applying the Mann-Whitney test to distances of the predicted SDPs to the functional site of the pro- tein compared to all amin o acid resudues of...

Ngày tải lên: 12/08/2014, 17:20