Báo cáo y học: " Does unrestrained single-chamber plethysmography provide a valid assessment of airway responsiveness in allergic BALB/c mice?" doc

Báo cáo y học: " Does unrestrained single-chamber plethysmography provide a valid assessment of airway responsiveness in allergic BALB/c mice?" doc

Báo cáo y học: " Does unrestrained single-chamber plethysmography provide a valid assessment of airway responsiveness in allergic BALB/c mice?" doc

... hyperresponsiveness (AHR) is a functional abnor- mality characteristic of bronchial asthma [1]. AHR in asthma is defined as an exaggerated response of the airway (lower airway in particular) to a variety of nonspecific stimuli, ... explanation may be that inhalation exposure includes nasal and gastro-intestinal uptake by Penh measurements. Penh may pick up all sources of r...
Ngày tải lên : 12/08/2014, 14:20
  • 11
  • 520
  • 0
Báo cáo y học: " Does the viral subtype influence the biennial cycle of respiratory syncytial virus?" pptx

Báo cáo y học: " Does the viral subtype influence the biennial cycle of respiratory syncytial virus?" pptx

... FAM-ACACCATCCAACGGAGCACAGGAGA- TAMRA. RSV B (N gene) f: AAGATGCAAATCATAAATTCACAGGA r: TGATATCCAGCATCTTTAAGTATCTTTATAGTG probe: FAM-AGGTATGTTATATGCTATGTCCAGGTTAG- GAAGGGAA-TAMRA. Statistical analysis was performed using STATISTICA ... Primers and probes for the TaqMan amplification of viral RNA from RSV A and B were: RSV A (N gene) f: AGATCAACTTCTGTCATCCAGCAA r: TGTGTTTCTGCACATCATAATTAGG...
Ngày tải lên : 12/08/2014, 04:20
  • 7
  • 321
  • 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

... cohort study [22], Ang- 2 correlated with mortality in a univariate analysis. In a surgical population with ARDS, Ang-2 predicted death with a similar discriminatory ability as the APACHE II score ... in a blinded fashion by the same investigator. Quantification of circulating Ang-1 and Ang-2 Ang-1 and Ang-2 were measured by in- house Immuno Radio- metric Sandwich Assay (IRMA...
Ngày tải lên : 25/10/2012, 10:31
  • 9
  • 634
  • 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

... increase in disability pension risk with increase in absence days/yr. A 10-day increase in ab- sence days per annum (scale score ranging from 0-220 days/yr) yielded an increase in disability pension ... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2). Additional analysis treating days of sickness ab- sence during 1990 as a continuous variable showed a...
Ngày tải lên : 26/10/2012, 10:03
  • 6
  • 578
  • 0
Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"

Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"

... R:5'-gggccttggtgttgggtaagagtcgtcttttcggggacaggaacagcaaagt-3' 195-197 TPR [pS/pT]X[R/K] PKA A5 89G_G59 0A_ G591C 195-197 TPR [pS/pT]X[R/K] PKC A5 89G_G59 0A_ G591C F:5'-aaaacaacctcttacccaacaccagacccctatccaaaacctgca-3' ... R:5'-tgtcgccggcatatgcgtaaatcctccactggggc-3' 65-69 KVFDS KXX[pS/pT] PKA T205G_C20 6A F:5'-ccagtgcaaagtctttgacgacttgctgaatctgagca...
Ngày tải lên : 03/11/2012, 11:17
  • 9
  • 592
  • 0
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx

Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx

... FT-IR-spectroscopy; Thermus thermophilus. Cytochrome c oxidase is the terminal enzyme of the respiratory chain in mitochondria and many prokaryotes. As an integral membrane protein it catalyzes the reduction of ... understanding, two pathways are necessary for the catalytic activity, but different residues may be involved. In an important step for the understanding of the essentials...
Ngày tải lên : 21/02/2014, 15:20
  • 9
  • 528
  • 0
Báo cáo Y học: Ligand-induced heterodimerization between the ligand binding domains of the Drosophila ecdysteroid receptor and ultraspiracle docx

Báo cáo Y học: Ligand-induced heterodimerization between the ligand binding domains of the Drosophila ecdysteroid receptor and ultraspiracle docx

... EMSA, electromobility shift assay; ST-EMSA, supershift-type electromobility shift assay; LBD, ligand binding domain; GBD, DNA binding domain of GAL4; GAD, activation domain of GAL4; DBD, DNA binding ... in yeast was functional and bound radioactively labelled ecdysteroid specifically. Ligand binding was greatly enhanced by the presence of a USP ligand binding domain. Therefore, ecdys...
Ngày tải lên : 18/03/2014, 01:20
  • 9
  • 331
  • 0
Báo cáo y học: "Prenatal allergen and diesel exhaust exposure and their effects on allergy in adult offspring mice" pptx

Báo cáo y học: "Prenatal allergen and diesel exhaust exposure and their effects on allergy in adult offspring mice" pptx

... alterations, perivascular, peribronchial airway inflammation, airway remodeling, and airway hyperreactivity were assessed in the adult offspring following prenatal exposure to diesel exhaust and/or A. fumigatus. ... will be associated with altered IgE production, airway inflammation, airway hyperreactivity (AHR), and airway remodeling of adult offspring. Methods: Following s...
Ngày tải lên : 08/08/2014, 21:20
  • 11
  • 369
  • 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

... Freeman GJ: The B7-CD28 superfamily. Nat Rev Immunol 2002, 2:116-126. 20. Matsuyama T, Yamada A, Kay J, Yamada KM, Akiyama SK, Schlossman SF, Morimoto C: Activation of CD4 cells by fibronectin and ... selectively express toll-like receptors and are activated by lipopolysaccharide. J Exp Med 2003, 197:403-411. 47. Nagai Y, Akashi S, Nagafuku M, Ogata M, Iwakura Y, Akira S, Kita- mura T, K...
Ngày tải lên : 09/08/2014, 01:23
  • 14
  • 505
  • 0
Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot

Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot

... autoimmune disease. Autoimmunity 2002, 35:1-14. 29. Yabuhara A, Yang FC, Nakazawa T, Iwasaki Y, Mori T, Koike K, Kawa H, Komiyama A: A killing defect of natural killer cells as an underlying immunologic abnormality ... preparation. SL carried out NK cytotox- icity assays and manuscript preparation. EHG carried out statistical analysis and manuscript preparation. TBG car- ried out patie...
Ngày tải lên : 09/08/2014, 06:22
  • 8
  • 365
  • 0

Xem thêm