Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx
... questionnaires and other arbitrary measures for disease classification. Adopting a systems biology approach, whereby a disease defining molecular fingerprint is analysed, would increase the accuracy of ... We are not alone in this vision, as others have also adopted this strategy as a way forward in molecular analysis. Alagaratnam et al are utilising Bayesian approaches to...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... 13 AD3.1 ND.1 AD8.2 AD3.2 ND.2 AD8.1 counts / million ATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG 0 70 140 210 280 hsa−mir−64 2a ... inhibition of the miR-30 family, RNA was extracted and analyzed at day 10 of differentiation. (b) For over-expression of pre-miR3 0a and pre-miR-30d, RN...
Ngày tải lên: 09/08/2014, 23:20
báo cáo khoa học: " Bundling occupational safety with harm reduction information as a feasible method for improving police receptiveness to syringe access programs: evidence from three U.S. cities" ppt
... justified by public officials as a means of enrolling drug users into treatment [38]. Qualitative research suggests that officers often view arrest and incarceration as fundamentally flawed approaches ... reduction training for police has also been conducted in other parts of East and Southeast Asia as well as the Ukraine [45,46]. Trainings directed at harmonizing law enforcem...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo y học: "Magnetic resonance imaging findings in bipartite medial cuneiform – a potential pitfall in diagnosis of midfoot injuries: a case series" pot
... radiologists and podiatrists should be aware of this osseous variation as it may be mistakenly diagnosed as a fracture and recognize that a bipartite medial cunei- form may be a cause of a non-traumatic ... medial cuneiform that the proximal articular surface of the first metatarsal bone was larger than usual. An asymptomatic bipartite medial cuneiform should not have associ...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: "Systems biology-defined NF-κB regulons, interacting signal pathways and networks are implicated in the malignant phenotype of head and neck cancer cell lines differing in p53 status" pps
... signal pathways and networks. The analysis of critical transcriptional modules, pathways and networks has been experimentally impractical, until the recent availability of large sets of data from ... and relationships through dynamical computation and manual extraction of A schematic diagram of computational, analytic and experimental strategiesFigure 1 A schematic diagram of...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Systems biology of gene regulation fulfills its promise" ppsx
... his data show that miRNAs act as strong modulators of many different transcripts and have a broad effect on mRNA targets. Gene-expression profiling affords investigators a view of steady-state ... presentations largely focused on identification and analysis of protein- DNA interactions, the discovery of cis-regulatory motifs, and the application of systems approaches to the...
Ngày tải lên: 14/08/2014, 16:21
Báo cáo y học: "Positive anti-citrullinated protein antibody status and small joint arthritis are consistent predictors of chronic disease in patients with very early arthritis: results from the NOR-VEAC cohort" pot
... to define a set of criteria for the diagnosis of early RA [13]. To avoid cir- cularity, the task force has proposed to use the start of DMARD therapy as a surrogate endpoint in the data-driven process ... (duration) was captured from the Rheumatoid Arthritis Disease Activity Index (RADAI) [17]. The assessor reported global evaluation of disease activity on a VAS. Erythrocy...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Testicular tuberculosis presenting with metastatic intracranial tuberculomas only: a case report" pot
... neurological symptoms of intracranial tuberculomas, which made the diagnosis of testicular tumor with intra- cranial metastases more likely and was readily embraced by the managing physici ans. A similar ... testicular cancer with intracranial metastases. Case presentation A 51-year-old African man was referred from a private facility with a two-month history of painless...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Extracorporeal immune therapy with immobilized agonistic anti-Fas antibodies leads to transient reduction of circulating neutrophil numbers and limits tissue damage after hemorrhagic shock/resuscitation in a porcine model" doc
... dehydrogenase (GAPDH) (hGAPDH-R: 5'-GAAGTCAGAGGAGACCACCA-3'; -F: 5'-CACCACCATGGAGAAGGCTG-3', Genosys-Sigma, Munich, Germany) were used as controls. 2.5 μl of cDNA were amplified ... functionalized biocompatible surfaces with agonistic anti-Fas in extracorporeal immune therapy may be more suitable than systemic application of anti- Fas because the latter approach...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx
... cases of patients with chronic hepatitis C virus infection developing aplastic anemia associated with pegylated interferon alpha 2a treatment. Case presentation: We report the case of a 46-year-old ... Vlahadami, Michael Voulgarelis * Abstract Introduction: Hepatitis-associated aplastic anemia is a common syndrome in patients with bone marrow failure. However, hepatitis-assoc...
Ngày tải lên: 11/08/2014, 03:21