0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx

Báo cáo y học:

Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx

... questionnaires and otherarbitrary measures for disease classification. Adopting a systems biology approach, whereby a disease definingmolecular fingerprint is analysed, would increase theaccuracy of ... We are not alone inthis vision, as others have also adopted this strategy as a way forward in molecular analysis. Alagaratnam et al areutilising Bayesian approaches to pursue muscular dystro-phy ... Sab-bagh MN, So YT, Sparks DL, Tabaton M, Tinklenberg J, Yesavage JA,Tibshirani R, Wyss-Coray T: Classification and prediction of clin-ical Alzheimer's diagnosis based on plasma signaling...
  • 17
  • 377
  • 0
Báo cáo y học:

Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

... 13AD3.1ND.1AD8.2AD3.2ND.2AD8.1counts / millionATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG070140210280hsa−mir−64 2a ... inhibition of themiR-30 family, RNA was extracted and analyzed at day 10 of differentiation. (b) For over-expression of pre-miR3 0a and pre-miR-30d,RNA was extracted and analyzed at day 4 of differentiation. ... smallRNA. Our small RNA cloning strategy only capturessmall RNAs that are, as miRNAs , 5’-phospho rylated and,thus, eliminates RNA degradation products generated bythe major cellular ribonucleases,...
  • 13
  • 365
  • 0
báo cáo khoa học:

báo cáo khoa học: " Bundling occupational safety with harm reduction information as a feasible method for improving police receptiveness to syringe access programs: evidence from three U.S. cities" ppt

... justified by public officials as a means of enrolling drug users into treatment [38].Qualitative research suggests that officers often view arrestand incarceration as fundamentally flawed approaches ... reduction training for police has alsobeen conducted in other parts of East and Southeast Asia as well as the Ukraine [45,46].Trainings directed at harmonizing law enforcement with public health activities ... it appears that many SAP operators and otherpublic health actors have failed to identify and adequatelyaddress the concerns of law enforcement in planning andimplementing SAPs, and rarely emphasize...
  • 8
  • 261
  • 0
Báo cáo y học:

Báo cáo y học: "Magnetic resonance imaging findings in bipartite medial cuneiform – a potential pitfall in diagnosis of midfoot injuries: a case series" pot

... radiologists and podiatrists should be aware of this osseous variation as it may be mistakenly diagnosed as a fracture and recognize that a bipartite medial cunei-form may be a cause of a non-traumatic ... medial cuneiformthat the proximal articular surface of the first metatarsalbone was larger than usual.An asymptomatic bipartite medial cuneiform should nothave associated bone marrow edema, as ... bearing, bracingand physical therapy, with partial relief and had no imag-ing follow-up.Case 2: Bipartite medial cuneiform A 34-year-old male long-distance runner with lateral met-atarsal...
  • 5
  • 271
  • 0
Báo cáo y học:

Báo cáo y học: "Systems biology-defined NF-κB regulons, interacting signal pathways and networks are implicated in the malignant phenotype of head and neck cancer cell lines differing in p53 status" pps

... signal pathways and networks. The analysis of criticaltranscriptional modules, pathways and networks has beenexperimentally impractical, until the recent availability of large sets of data from ... and relationshipsthrough dynamical computation and manual extraction of A schematic diagram of computational, analytic and experimental strategiesFigure 1 A schematic diagram of computational, ... transcription factornuclear factor-kappaB by a mutant inhibitor-kappaBalphaattenuates resistance of human head and neck squamouscell carcinoma to TNF-alpha caspase-mediated cell death. BrJ Cancer...
  • 22
  • 434
  • 0
Báo cáo y học:

Báo cáo y học: "Systems biology of gene regulation fulfills its promise" ppsx

... his data show that miRNAsact as strong modulators of many different transcripts andhave a broad effect on mRNA targets. Gene-expression profiling affords investigators a view of steady-state ... presentationslargely focused on identification and analysis of protein-DNA interactions, the discovery of cis-regulatory motifs, andthe application of systems approaches to the study of post-transcriptional ... USA)presented an elegant example of the application of a systems- level approach to a posttranscriptional process. Heused microarrays to elucidate the effects of miRNAs onmRNA levels in HeLa cells, and...
  • 3
  • 233
  • 1
Báo cáo y học:

Báo cáo y học: "Positive anti-citrullinated protein antibody status and small joint arthritis are consistent predictors of chronic disease in patients with very early arthritis: results from the NOR-VEAC cohort" pot

... to define a set of criteria for the diagnosis of early RA [13]. To avoid cir-cularity, the task force has proposed to use the start of DMARD therapy as a surrogate endpoint in the data-drivenprocess ... (duration)was captured from the Rheumatoid Arthritis Disease ActivityIndex (RADAI) [17]. The assessor reported global evaluation of disease activity on a VAS. Erythrocyte sedimentation rate(ESR) ... therapy without a RA diagnosis. Although 68 (17.7%) patients had a RA diagnosis at one year,an additional 78 (20.3%) patients had either persistent syno-vitis or had received DMARD therapy, and...
  • 8
  • 328
  • 0
Báo cáo y học:

Báo cáo y học: "Testicular tuberculosis presenting with metastatic intracranial tuberculomas only: a case report" pot

... neurological symptoms of intracranial tuberculomas,which made the diagnosis of testicular tumor with intra-cranial metastases more likely and was readily embracedby the managing physici ans. A similar ... testicular cancer with intracranialmetastases.Case presentation A 51-year-old African man was referred from a privatefacility with a two-month history of painless scrotalswelling and a one-week ... testicular tuberculosis and multipleintracranial tuberculomas who was initially managed for testicular cancer with intracranial metastasis. He hadundergone left radical orchidectomy, but subsequently...
  • 5
  • 417
  • 0
Báo cáo y học:

Báo cáo y học: "Extracorporeal immune therapy with immobilized agonistic anti-Fas antibodies leads to transient reduction of circulating neutrophil numbers and limits tissue damage after hemorrhagic shock/resuscitation in a porcine model" doc

... dehydrogenase (GAPDH)(hGAPDH-R: 5'-GAAGTCAGAGGAGACCACCA-3'; -F:5'-CACCACCATGGAGAAGGCTG-3', Genosys-Sigma,Munich, Germany) were used as controls. 2.5 μl of cDNAwere amplified ... functionalized biocompatible surfaces with agonistic anti-Fas in extracorporeal immune therapymay be more suitable than systemic application of anti-Fas because the latter approach has been ... Hospital, Düsseldorf, Germany, 2Department of Thoracic and Cardiovascular Surgery, University Hospital, Frankfurt am Main, Germany, 3Department of Vascular Surgery, Faculdade Medicina Marilia...
  • 13
  • 375
  • 0
Báo cáo y học:

Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx

... cases of patients with chronic hepatitis C virus infection developing aplastic anemia associated with pegylated interferon alpha 2a treatment.Case presentation: We report the case of a 46-year-old ... Vlahadami, Michael Voulgarelis*AbstractIntroduction: Hepatitis-associated aplastic anemia is a common syndrome in patients with bone marrow failure.However, hepatitis-associated aplastic anemia ... CAS E REP O R T Open AccessAplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virusinfection: a case reportSavvas Ioannou, Gregorios Hatzis, Ioanna...
  • 5
  • 352
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI