Báo cáo y học: " Membrane diffusion- and capillary blood volume measurements are not useful as screening tools for pulmonary arterial hypertension in systemic sclerosis: a case control study" pptx

Báo cáo y học: " Membrane diffusion- and capillary blood volume measurements are not useful as screening tools for pulmonary arterial hypertension in systemic sclerosis: a case control study" pptx

Báo cáo y học: " Membrane diffusion- and capillary blood volume measurements are not useful as screening tools for pulmonary arterial hypertension in systemic sclerosis: a case control study" pptx

... a decrease in capillary flow and thus a decrease in Vc. This will result in a reduction in surface area available for gas exchange, and therefore in a decrease of Dm [25]. Sec- ondly, parenchymal and ... tompography; IPAH: idiopathic pulmonary arterial hypertension; PAH: pulmonary arterial hypertension; Ppa: pulmonary artery pressure; PCWP: pulmonary...

Ngày tải lên: 12/08/2014, 14:20

8 264 0
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx

Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx

... contractile performance and metabolic capacity in a high-frequency muscle. Physiol Biochem Zool 2006, 79:20-30. 13. Matsubara K, Tarui H, Toriba M, Yamada K, Nishida-Umehara C, Agata K, Matsuda Y: Evidence ... mechanisms that underlie regu- lation of organ performance and regeneration. ese animals are also readily obtained from commercial breeders, non-aggressive, and easier...

Ngày tải lên: 09/08/2014, 23:20

8 410 0
Báo cáo y học: "Membrane transporters and protein traffic networks differentially affecting metal tolerance: a genomic phenotyping study in yeas" potx

Báo cáo y học: "Membrane transporters and protein traffic networks differentially affecting metal tolerance: a genomic phenotyping study in yeas" potx

... Chang A: An endosome-to-plasma membrane path- way involved in trafficking of a mutant plasma membrane ATPase in yeast. Mol Biol Cell 2000, 11:579-592. 89. Nothwehr SF, Ha SA, Bruinsma P: Sorting ... 5'-(CGCGGACCGTTAACTGATATCACCATGAGACATG)-3' SMF2 Forward 5'-(CGCGGTCCGCTACGTAGCCACCATGACGTCCCAAGAATATGAACC)-3' SMF2 Reverse 5'-(CGCGGACCGTTAGAGGTGTACTTCTTTGCCCG)...

Ngày tải lên: 14/08/2014, 08:21

19 252 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

... the agents now in use. This treatment is especially promising in autoimmune dis- eases characterized by a relapsing and remitting course such as SLE, inflammatory bowel disease or certain forms of ... circulating myelin basic protein and proteolipid protein-specific transforming growth factor-beta1- secreting Th3 T cells by oral administration of myelin in multi- ple sclerosis p...

Ngày tải lên: 09/08/2014, 03:24

6 409 0
Báo cáo y học: " Brain size and brain/intracranial volume ratio in major mental illness" doc

Báo cáo y học: " Brain size and brain/intracranial volume ratio in major mental illness" doc

... bone and tissue external to this boundary was stripped leaving ICV containing brain and CSF for that slice. Next the estimate of CSF - brain boundary was examined and corrected visually by hand as ... determined all intracranial and brain volumes over the total c ourse of the study. Formal training in brain volume identification including accurate delineation of the skull -CSF...

Ngày tải lên: 11/08/2014, 16:22

9 385 0
Báo cáo y học: "Natural history and clinical significance of MRI-detected bone marrow lesions at the knee: a prospective study in community dwelling older adults" pot

Báo cáo y học: "Natural history and clinical significance of MRI-detected bone marrow lesions at the knee: a prospective study in community dwelling older adults" pot

... designed and carried out the study planning, participated in analysis and interpretation of the data, and critically revised the manuscript. All authors have read and approved the final manuscript. Dore ... properly cited. variation in study designs. We assessed BMLs by mea- suring the maximal area at baseline and follow-up. We then calculated whether there was an actual change...

Ngày tải lên: 12/08/2014, 15:22

12 333 0
Báo cáo y học: " Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines" ppt

Báo cáo y học: " Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines" ppt

... Reverse Beta-actinF/Beta-actinR - AGGTCATCACCATTGGCAATG CCCAAGAAAGATGGCTGGAA GAPDHF/GAPDHR - GGGAAGCTTACTGGAATGGCT GGCAGGTCAGGTCAACAACA POMCF/POMCR - GCTACGGCGGCTTCATGA CGATGGCGTTTTTGAACAGAG PMCHF/PMCHR - CGAAATGGAGACGGAACTGAA ... CGAAATGGAGACGGAACTGAA CATCCAAGAAGCTTTCCTCAATCT Val_envF/Val_envR b* ACCCGGACATCACCCAAAG AGTCAGAAATGCCTGCAAAAAGA chENV232fwd/chENV1046rev e* ACGGATTTCTGCCTCTCTACACA...

Ngày tải lên: 12/08/2014, 23:21

13 284 0
Báo cáo y học: "Alcohol intoxication and mental health among adolescents – a population review of 8983 young people, 13–19 years in North-Trøndelag, Norway: the Young-HUNT Study" pot

Báo cáo y học: "Alcohol intoxication and mental health among adolescents – a population review of 8983 young people, 13–19 years in North-Trøndelag, Norway: the Young-HUNT Study" pot

... research, statistical analysis, drafting and presentation. NB was essential in the development of the idea, description and thinking of the study, as well as drafting of the article. All authors ... measure. More than 10 intoxications were defined as high alcohol use in all age groups. The same definition has been used in previous studies and is known to be easy to collect,...

Ngày tải lên: 13/08/2014, 18:21

7 265 0
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

... protein activates the ras/ mitogen-activated protein kinase pathway and (b) phosphatidylinositol 3-kinase activates the protein kin- ase B/glycogen synthase kinase-3 cascade. Recent data suggest ... extracted with ether and immediately benzoylated, as described by Blank et al. [32]. Diradylglycerobenzoates were separated into their subclasses (diacyl, alkylacyl, and alk-1- enylacyl ty...

Ngày tải lên: 20/02/2014, 02:21

12 592 0
Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf

Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf

... serum and a FITC-conjugated second- ary antibody, green staining) and neuronal specific enolase (using a rabbit polyclonal antiserum and an anti-rabbit polyclonal antibody made in goat conjugated ... from tropical Africa and Madagascar island) and the lineage I (tropical african strains) that caused the outbreaks of WNV infec- tion in North Africa, Europe, Israel, and in...

Ngày tải lên: 18/06/2014, 22:20

5 404 0
w