Báo cáo y học: " CD39+ Regulatory T cells suppress generation and differentiation of Th17 cells in human malignant pleural effusion via a LAP-dependent mechanism" pps

Báo cáo y học: " CD39+ Regulatory T cells suppress generation and differentiation of Th17 cells in human malignant pleural effusion via a LAP-dependent mechanism" pps

Báo cáo y học: " CD39+ Regulatory T cells suppress generation and differentiation of Th17 cells in human malignant pleural effusion via a LAP-dependent mechanism" pps

... indicate that CD39 + Tregs inhibit generation and differentiation of Th17 cells via a latency-associated peptide-dependent mechanism. Keywords: latency-associated peptide, malignant pleural effusion, ... doi:10.4049/jimmunol.0901881 doi:10.1186/1465-9921-12-77 Cite this article as: Ye et al.: CD39 + Regulatory T cells suppress generation and differentiation...

Ngày tải lên: 12/08/2014, 13:22

10 441 0
Báo cáo y học: " Adipose tissue transcriptomic signature highlights the pathological relevance of extracellular matrix in human obesity" pot

Báo cáo y học: " Adipose tissue transcriptomic signature highlights the pathological relevance of extracellular matrix in human obesity" pot

... family, and suggested that these elements could play a major mediating role in a chain of interactions that connect local inflammatory phenomena to the alteration of WAT metabolic functions in ... mechanisms that link inflamma- tory changes to the development, aggravation, maintenance, and resistance to treatment that characterize obesity states remain poorly understood. White...

Ngày tải lên: 14/08/2014, 08:20

32 429 0
Báo cáo y học: "CD25brightCD4+ regulatory T cells are enriched in inflamed joints of patients with chronic rheumatic disease" potx

Báo cáo y học: "CD25brightCD4+ regulatory T cells are enriched in inflamed joints of patients with chronic rheumatic disease" potx

... 3d). Last, we took into account the local, intra-articular, treat- ments that the patients were receiving. Only those patients with documentation of intra-articular cortisone injection within 3 ... These features were apparent in the vast majority of the patients despite the different treatments they received, indicating that the anti-rheumatic drugs that patients receive do not affect...

Ngày tải lên: 09/08/2014, 01:23

12 425 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

... CCCGGACGTCTAAACCAAACC GGGGATCAATAGAGGGGGAAATA 512 ATPase6 AATTACCCCCATACTCCTTACACT GGGTCATGGGCTGGGTTTTACTAT 857 COX-I CCTCGGAGCTGGTAAAAA GGGGGTTCGATTCCTTC 1654 COX-II ACTACCCCGATGCATACACCACA GGGCAATGAATGAAGCGAACAG ... GGGCAATGAATGAAGCGAACAG 1333 COX-III GCCGTACGCCTAACCGCTAACA TCGTAAGGGGTGGTTTTTCTATG 1177 Cyt b CGCACGGACTACAACCACGAC GGACAGGCCCATTTGAGTATTTTG 1212 Statistical Analysis...

Ngày tải lên: 25/10/2012, 11:18

12 557 2
Báo cáo y học: "BACE-1 inhibition prevents the g-secretase inhibitor evoked Ab rise in human neuroblastoma SH-SY5Y cells" ppsx

Báo cáo y học: "BACE-1 inhibition prevents the g-secretase inhibitor evoked Ab rise in human neuroblastoma SH-SY5Y cells" ppsx

... elevated concentrations of Ab. Rec ently, a phase III clinical trial with LY450139 (semagacestat) in AD patients was dis- continued prematurely [14]. Surprisingly it was reported that patients receiving LY450139 ... acids (PAA) and 10% Fetal Bovine Serum (PAA). Cells were maintain ed at 37°C in a humidified atmosphere contain- ing 5% CO 2 . SH-SY 5Y cells were stably transfec...

Ngày tải lên: 10/08/2014, 10:20

9 315 0
Báo cáo y học: "Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells" ppsx

Báo cáo y học: "Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells" ppsx

... that laboratory stocks of HIV-1 are contaminated with DNA that is acquired from PBMCs during viral propagation (data not shown). The contaminating DNA was substantially resist- ant to DNase treatment ... Biosciences). Competing interests The authors declare that they have no competing interests. Authors' contributions AV contributed to the design of the study, evaluated the data, dra...

Ngày tải lên: 13/08/2014, 05:21

14 319 0
Báo cáo y học: "Maitake Mushroom Extracts Ameliorate Progressive Hypertension and Other Chronic Metabolic Perturbations in Aging Female Rats"

Báo cáo y học: "Maitake Mushroom Extracts Ameliorate Progressive Hypertension and Other Chronic Metabolic Perturbations in Aging Female Rats"

... included a water extract and an ether extract, and the two rat species examined were genetically hypertensive rats (spontaneously hypertensive rats [SHR]) and genetically insulin-resistant rats ... Estimating ACE ac- tivity, it was found that the activity was statistically lower than control in the captopril, fraction D, and fraction SX groups and the lessened activity trend...

Ngày tải lên: 26/10/2012, 08:57

12 469 0
Báo cáo Y học: The sodium pump Its molecular properties and mechanics of ion transport potx

Báo cáo Y học: The sodium pump Its molecular properties and mechanics of ion transport potx

... Moreover, crystallo- graphic studies have demonstrated that Na + /K + -ATPase crystallizes in a way that allows ab protomers to be in close contact with each other [19]. Finally, radiation inactivation has ... Reaction cycle of Na + /K + -ATPase. Na + /K + -ATPase binds Na + and ATP in the E 1 conformational state (step 1) and is phosphorylated at an aspartate residue by the c-p...

Ngày tải lên: 24/03/2014, 00:21

10 488 0
Báo cáo y học: "Association between the TNFRII 196R allele and diagnosis of rheumatoid arthritis" potx

Báo cáo y học: "Association between the TNFRII 196R allele and diagnosis of rheumatoid arthritis" potx

... genotypes were uninterpretable. Indeed, DNA material for 31 patients was not available either because of patient refusal to participate in the Table 1 Baseline characteristics of the 314 patients ... Nishimoto N, Yoshizaki K, Miyasaka N, Yamamoto K, Kawai S, Takeuchi T, Hashimoto J, Azuma J, Kishimoto T: Treatment of rheumatoid arthritis with humanized anti-interleukin-6 recep- tor...

Ngày tải lên: 09/08/2014, 06:23

7 585 0
Báo cáo y học: "Celastrus aculeatus Merr. suppresses the induction and progression of autoimmune arthritis by modulating immune response to heat-shock protein 65" pptx

Báo cáo y học: "Celastrus aculeatus Merr. suppresses the induction and progression of autoimmune arthritis by modulating immune response to heat-shock protein 65" pptx

... comparable to that of methotrexate. Celastrus treatment induced relative deviation of the cytokine response to anti-inflammatory type and enhanced the production of anti-Bhsp65 antibodies, which are known ... con- trol rats (Figure 1a c). The effect of Celastrus on clinical arthri- tis was also validated by histological examination of arthritic joints. The results (Table 1) show t...

Ngày tải lên: 09/08/2014, 10:20

10 363 0
w