Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt

Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt

Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt

... 12:R93 http://arthritis-research.com/content/12/3/R93 Page 12 of 13 Competing interests Mohamad Navab and Alan M. Fogelman are principals in Bruin Pharma and Alan M. Fogelman is an officer in Bruin Pharma. The remaining authors have no competing ... [20,22,23]. Apolipoprotein A- 1 (apoA-1), a major component of high-density lipoproteins (HDL), plays an important role in the a...

Ngày tải lên: 12/08/2014, 12:20

13 360 0
Báo cáo y học: "β Treatment with recombinant interferon-β reduces inflammation and slows cartilage destruction in the collagen-induced arthritis model of rheumatoid arthritis" ppt

Báo cáo y học: "β Treatment with recombinant interferon-β reduces inflammation and slows cartilage destruction in the collagen-induced arthritis model of rheumatoid arthritis" ppt

... volunteers. J Interferon Cytokine Res 2000, 20:857- 866. 28. Miyazaki T, Katagiri H, Kanegae Y, Takayanagi H, Sawada Y, Yamamoto A, Pando MP, Asano T, Verma IM, Oda H, Nakamura K, Tanaka S: Reciprocal role ... demonstrated statistically significant modulation of proinflammatory and anti-inflammatory cyto- kine production in animals treated with IFN-β. We found a statistically sign...

Ngày tải lên: 09/08/2014, 01:23

11 345 0
Báo cáo y học: "Treatment with ephrin B2 positively impacts the abnormal metabolism of human osteoarthritic chondrocytes" pdf

Báo cáo y học: "Treatment with ephrin B2 positively impacts the abnormal metabolism of human osteoarthritic chondrocytes" pdf

... 5'-TGGGCAGACTCAAATTCCAG IL-6 5'-CACCTCTTCAGAACGAATTG 5'-CTAGGTATACCTCAAACTCC PAR-2 5'-GAAGCCTTATTGGTAAGGTTG 5'-CAGAGAGGAGGTCAGCCAAG MMP-1 5'-CTGAAAGTGACTGGGAAACC 5'-AGAGTTGTCCCGATGATCTC MMP-2 ... 5'-AGAGTTGTCCCGATGATCTC MMP-2 5'-CACTGTTGGTGGGAACTCAG 5'-GTGTAAATGGGTGCCATCAG MMP-9 5'-CCTTCACTTTCCTGGGTAAG 5'-CCATTCACGTCGTCCTTATG MMP-13...

Ngày tải lên: 09/08/2014, 14:22

10 401 0
Báo cáo y học: " Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation" pdf

Báo cáo y học: " Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation" pdf

... anti -murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation Yang Fan, Wu Weifeng 1,2* , Yan Yuluan, Kong Qing, Pang Yu, Huang Yanlan Abstract Background: ... length IL-6[GenBank:16193] sense: 5’CACAGAAGGAGTGGCTAAGGACCA3’ antisense: 5’ACGCACTAGGTTTGCCGAGTAGA3’ 103 bp IL-17[GenBank:16171] sense: 5’GTCAATGCGGAGGGAAAG3’...

Ngày tải lên: 11/08/2014, 21:21

7 255 0
Báo cáo y học: "Immunization with an immunodominant self-peptide derived from glucose-6-phosphate isomerase induces arthritis in DBA/1 mice" pot

Báo cáo y học: "Immunization with an immunodominant self-peptide derived from glucose-6-phosphate isomerase induces arthritis in DBA/1 mice" pot

... preparation does not influence this assay (data not shown). Cells were stained with a viability dye (Aqua fixable live/dead staining kit; Invitrogen, Karlsruhe, Germany) according to the manufacturer's ... peptide and protein immunization, whereas Iwanami and colleagues use intradermal injection of peptide in CFA fol- lowed by two injections of pertussis toxin intraperitone...

Ngày tải lên: 09/08/2014, 14:22

11 293 0
Báo cáo y học: "Delayed intracardial shunting and hypoxemia after massive pulmonary embolism in a patient with a biventricular assist device" pdf

Báo cáo y học: "Delayed intracardial shunting and hypoxemia after massive pulmonary embolism in a patient with a biventricular assist device" pdf

... bypass and after LVAD activation [12,13]. Alter- natively, manual occlusion of the pulmonary artery shortly before activatio n of the LVAD by the surgeon and transesophageal echocardiography studies ... familial dilated cardiomyopathy. Recompensation was not achieved despite maximum medical therapy and inser- tion of an intra-aortic balloon pump. BVAD [Excor, Ber- lin Heart, Berlin, G e...

Ngày tải lên: 10/08/2014, 09:22

4 379 0
Báo cáo y học: " Spontaneous coronary artery dissection presenting as an ischaemic stroke in a middle-aged man with anti-cardiolipin antibodies: a case report" ppsx

Báo cáo y học: " Spontaneous coronary artery dissection presenting as an ischaemic stroke in a middle-aged man with anti-cardiolipin antibodies: a case report" ppsx

... rest of the coronary arteries were all normal. In view of the above, a diagnosis of SCAD in association with anti-cardiolipin antibodies was made. SCAD had resulted in myocardial infarction leading ... ventricular thrombus. Case presentation A 56-year-old, Caucasian man presented with dy sarthri a and right-sided weakness to a district general hospital. There was a h...

Ngày tải lên: 11/08/2014, 12:20

4 413 0
Báo cáo y học: " Pancreatitis with an unusual fatal complication following endoscopic retrograde cholangiopancreaticography: a case report" ppt

Báo cáo y học: " Pancreatitis with an unusual fatal complication following endoscopic retrograde cholangiopancreaticography: a case report" ppt

... CT scanning. Abbreviations ALAT: alanine aminotransferase; ASAT: aspartate ami- notransferase; CT: computed tomography; ERCP: endo- scopic retrograde cholangiopancreaticography; VLDL: very low-density ... capillary leakage and loss of surfactant, and the formation of hya- line membranes. Classical fat embolism is characterised by the triad of res- piratory distress, mental disturbances...

Ngày tải lên: 11/08/2014, 21:22

4 286 0
Báo cáo y học: "Patients with ischaemic, mixed and nephrotoxic acute tubular necrosis in the intensive care unit – a homogeneous population" pps

Báo cáo y học: "Patients with ischaemic, mixed and nephrotoxic acute tubular necrosis in the intensive care unit – a homogeneous population" pps

... AF, Rai H, Bapat M, Chitalia KV, Acharya VN, Khanna R: Is peritoneal dialysis adequate for hypercatabolic acute renal failure in developing countries? Kidney Int 2002, 61:747-757. Critical Care ... was called late or not even called at all because of 'do no resusci- tate' orders. It is interesting that the ICU stay of dialyzed patients was 20.4 days as compared with 10.8 day...

Ngày tải lên: 12/08/2014, 23:23

9 374 0
Báo cáo y học: "Circulating immune complexes and complement C3 and C4 levels in a selected group of patients with rhinitis in Lebanon" pot

Báo cáo y học: "Circulating immune complexes and complement C3 and C4 levels in a selected group of patients with rhinitis in Lebanon" pot

... infants at high risk of asthma. Lancet 2000, 13(355 (9216)):1680-1683. 21. Andersson M, Laukkanen M, Salkinojasalonen M: 3-Hydroxy fatty acids: Stable indicators of endotoxin in hay and straw dust. Journ ... produced at a wavelength of 450 nm using patients' serum as a blank. The results obtained paralleled those obtained when the C 1q assay was used. The absorbance values t...

Ngày tải lên: 13/08/2014, 13:22

4 221 0
Từ khóa:
w