Báo cáo y học: "Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial" pdf

Báo cáo y học: "Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial" pdf

Báo cáo y học: "Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial" pdf

... Access Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial Kevin R Fontaine 1* , Lora Conn 1 , Daniel J Clauw 2 Abstract Introduction: ... often substantially hampers day-to-day functioning and is a primary cause of disability [5]. Even with the recent Food an...

Ngày tải lên: 12/08/2014, 12:20

9 381 0
Báo cáo y học: "The relationship between disease activity, sleep, psychiatric distress and pain sensitivity in rheumatoid arthritis: a cross-sectional study" docx

Báo cáo y học: "The relationship between disease activity, sleep, psychiatric distress and pain sensitivity in rheumatoid arthritis: a cross-sectional study" docx

... [23-27] among healthy individuals and individuals with non-inflammatory pain syndromes; prevalent among the RA population [5,28-31]; and associated with reported pain severity among RA patients ... pain as a priority. The etiology of RA pain is likely multifactorial, including both inflammatory and non-inflammatory components. In this study, we examine the association between...

Ngày tải lên: 09/08/2014, 14:22

11 563 0
Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps

Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps

... COL1 0A1 , 5'- TACCTTGTGCCTCCCATTCAA-3' (forward) and 5'-TACAG- TACAGTGCATAAATAAATAATATATCTCCA-3' (reverse); COL1 1A2 , 5'-CCTGAGCCACTGAGTATGTTCATT-3' (for- ward) and 5'-TTGCAGGATCAGGGAAAGTGA-3' ... 5'- CACCAGATATCGACAGAGTGGTCTT-3' (forward) and 5'- CAGGGTTAAAGGCAAAGGGATAA-3' (reverse); SOX9, 5'- CTTTGGTTTGTGTTCGTGTTTTG-3&...

Ngày tải lên: 09/08/2014, 10:20

9 307 0
Báo cáo y học: " Maleic anhydride-modified chicken ovalbumin as an effective and inexpensive anti-HIV microbicide candidate for prevention of HIV sexual transmission" pdf

Báo cáo y học: " Maleic anhydride-modified chicken ovalbumin as an effective and inexpensive anti-HIV microbicide candidate for prevention of HIV sexual transmission" pdf

... the human body, especially in the vaginal flora, which pre- dominantly hydrolyzes proteins/peptides at the carboxyl side of arginine and lysine residues. Since most lysine and arginine residues in ... mucosal immuni- zation through intravaginal and intrarectal administra- tion with soluble proteins, including OVA, in absence of adjuvants, are usually unable to induce strong...

Ngày tải lên: 12/08/2014, 23:23

18 288 0
Báo cáo y học: "Parenteral versus enteral nutrition: effect on serum cytokines and the hepatic expression of mRNA of suppressor of cytokine signaling proteins, insulin-like growth factor-1 and the growth hormone receptor in rodent sepsis" pps

Báo cáo y học: "Parenteral versus enteral nutrition: effect on serum cytokines and the hepatic expression of mRNA of suppressor of cytokine signaling proteins, insulin-like growth factor-1 and the growth hormone receptor in rodent sepsis" pps

... signaling by a negative feedback loop involving the janus kinase and signal transducer and activator pathway [12]. Yumet and colleagues [13] have recently shown in rats with abdominal sepsis that total ... common cellular receptor. The suppressors of cytokine signaling (SOCS) proteins are inhibitors of cytokine and GH signaling via the janus kinase and signal transducer a...

Ngày tải lên: 13/08/2014, 08:20

8 319 0
Báo cáo sinh học: "High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

Báo cáo sinh học: "High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

... P, Papakostas P, et al: Induction chemotherapy with docetaxel and cisplatin followed by concomitant chemoradiotherapy in patients with inoperable non-nasopharyngeal carcinoma of the head and ... surgery and stan- dard radiotherapy alone [12]. In Taiwan, for public healthy insurance, cisplatin is the backbone of the chemotherapy regimen as a component of IC and CCRT in...

Ngày tải lên: 18/06/2014, 19:20

8 690 0
báo cáo hóa học:" High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

báo cáo hóa học:" High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

... the clinical data of patients and performed statistical data analysis. YJC coordinated the study and were involved in drafting the manuscript and revised it critically. All authors read and approved ... ERCC1 and XRCC1 and radioresistance in laryngeal tumors [33]. Cetuximab is an IgG1 monoclonal antibody against the ligand-binding domain of EGFR. Cetuximab binds Table 3 Un...

Ngày tải lên: 20/06/2014, 03:20

8 429 0
Báo cáo y học: "Pyridoxine supplementation corrects vitamin B6 deficiency but does not improve inflammation in patients with rheumatoid arthritis" pps

Báo cáo y học: "Pyridoxine supplementation corrects vitamin B6 deficiency but does not improve inflammation in patients with rheumatoid arthritis" pps

... biochemical analyses, data acqui- sition, analysis and interpretation, and drafted the manuscript. JS participated in the design of the study, acquisition of fund- ing, and was involved in revising ... MA, USA). Pyridoxal 5'-phosphate concentration was assayed by the tyrosine decarboxylase enzymatic procedure of Camp et al. [20] with a modification of the extraction...

Ngày tải lên: 09/08/2014, 07:20

8 416 0
Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

... CTTGTTTACAGTCTGCTCA-AAATATCTT P4Hα(I) Forward 5'-3' GCAGGGTGGTAATATTGGCATT Reverse 5'-3' AAATCAATTCCCTCATCACTGAAAG, P4Hα(II) Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAA Reverse ... AGCTTCTGTGGAACCATGGAA COL 2A1 Forward 5'-3' CTGCAAAATAAAATCTCGGTGTTCT Reverse 5'-3' GGGCATTTGACTCACACCAGT HIF-1α Forward 5-3' GTAGTTGTGGAAGT-TTATGCTAATATTGTGT Reverse...

Ngày tải lên: 09/08/2014, 10:20

9 356 0
Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

... BrdU incorporation was measured by a colorimetric assay as a parameter for DNA synthesis. For evaluation of cell viability and metabolic activity the MTT assay was used. The assay is based on the ... capacity of AGEs to modulate FLS towards inflammation and cartilage degradation and amplify OA [17]. As the RAGE gene promoter region contains NFκB binding sites NFκB activation...

Ngày tải lên: 09/08/2014, 14:22

19 395 0
Từ khóa:
w