Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf
Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf
... this article as: Davies-Tuck et al., Development of bone marrow lesions
is associated with adverse effects on knee cartilage while resolution is associ-
ated with improvement - a potential target ... cited.
Research article
Development of bone marrow lesions is associated
with adverse effects on knee cartilage while
resolu...
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... SDS/PAGE. Autoradio-
graphy was carried out on a BAS-IP NP 2040P imaging
plate. Radioactivity was monitored with a Fujix BAS 2000
scanner (Raytest, Straubenhardt). Gel documentation was
accomplished ... Germany;
2
Institute for Molecular Biosciences, The University of Queensland, St Lucia,
Australia
A novel photoactivatable analog of antisauvagine-30 (aSvg-
30), a specific an...
Báo cáo y học: "Detection of bone erosions in rheumatoid arthritis wrist joints with magnetic resonance imaging, computed tomography and radiography" ppt
... were as suggested by OMERACT
RAMRIS; that is, a sharply marginated bone lesion, with cor-
rect juxtaarticular localisation and typical signal characteris-
tics, visible in two planes with a cortical ... the
metacarpophalangeal joints, and many of the small carpal
bones have irregular margins with indentations (for example, at
the attachment of ligaments), making discriminati...
Báo cáo y học: "Suppression of bone morphogenetic protein inhibitors promotes osteogenic differentiation: therapeutic implications" doc
... or
chordin - controls several BMPs (specifically BMP-2, -4 and
-7 ) and therefore allows their natural synergy to regenerate
bone in a physiological state. This takes advantage of the
endogenous BMP cascade ... fracture healing. J Bone Miner
Res 2002, 17:51 3-5 20.
3. Sakou T, Onishi T, Yamamoto T, Nagamine T, Sampath T, Ten
Dijke P: Localization of Smads, the TGF-beta f...
Báo cáo y học: "Development of a health care utilisation data-based index for rheumatoid arthritis severity: a preliminary study" ppt
... rheumatoid arthritis records-based index of severity (RARBIS) with and without
medication sub-scale
RARBIS with medication sub-scale RARBIS without medication sub-scale
Claims-based variables Correlation ... How-
ever, because the VA contains rich data from both medical
record and health care utilisation databases, it is a unique and
ideal data source for our analysis. Additional...
Báo cáo y học: "Development of daily rhythmicity in heart rate and locomotor activity in the human fetus" ppt
... "Decelera-
tion" points to a decrease in compensatory mechanisms,
while "zero-type" reaction is indicative of an unsatisfac-
tory condition of the fetus.
The analysis of 24-hour fetal ... Konstantinova NN: Disturbance of placental circulation and
cardiac performance of the fetus (pathogenesis and theoret-
ical prerequisites to early diagnosis and treatment)...
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA)
and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele-
specific primer s Pnf (AGCATTTGGTTTTAAATTATG-
GAGTATATG) and Pmr (GTTTTACTTACTCTCGT
CTCCACAAAA). The PCR was run for 35 cycles with
each cycle consisting ... Detection of the JAK2V617F
mutation by asymmetric PCR and melt curve analysis. Cancer Biomark
2007, 3:31 5-3 24.
23. Rapado I, Albizua E, Ayala R, Hernández JA,...
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
... guidelines have been published in
the UK and Australasia, specifically for medical practi-
tioners for melanoma [6 0-6 2] but none are known to
exist specifically for lesions arising on the foot. A review
of ... strategy. A literature search was under-
taken using the National Library of Medicine (NLM)
PubMed database to identify literature on foot and nail
melanoma. A...
Báo cáo y học: "Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pdf
... no association between
plasmapheresis treatment and acute onset of facial neuropathy has been reported.
Case presentation: A 35-year-old Caucasian man with no significant prior medical history ... immune-mediated
acute polyneuropathy typically characterized by ascend-
ing weakness and areflexia. An associatio n with Campy-
lobacter jejuni infection is most common; however,
numerous...
Báo cáo y học: "Development of a theory of implementation and integration: Normalization Process Theory" ppsx
... make
rational decisions about face validity, and to ask whether
the NPM merited formal testing. This consisted of two
main pieces of work, quantitative data analysis and
research synthesis.
Qualitative ... organization. We developed
an applied theoretical model through analysis of empirical generalizations. Finally, we built a formal theory
through a process of extension and impli...