Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf

Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf

Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf

... this article as: Davies-Tuck et al., Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associ- ated with improvement - a potential target ... cited. Research article Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolu...

Ngày tải lên: 12/08/2014, 11:22

8 373 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

... SDS/PAGE. Autoradio- graphy was carried out on a BAS-IP NP 2040P imaging plate. Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt). Gel documentation was accomplished ... Germany; 2 Institute for Molecular Biosciences, The University of Queensland, St Lucia, Australia A novel photoactivatable analog of antisauvagine-30 (aSvg- 30), a specific an...

Ngày tải lên: 31/03/2014, 08:20

7 345 0
Báo cáo y học: "Detection of bone erosions in rheumatoid arthritis wrist joints with magnetic resonance imaging, computed tomography and radiography" ppt

Báo cáo y học: "Detection of bone erosions in rheumatoid arthritis wrist joints with magnetic resonance imaging, computed tomography and radiography" ppt

... were as suggested by OMERACT RAMRIS; that is, a sharply marginated bone lesion, with cor- rect juxtaarticular localisation and typical signal characteris- tics, visible in two planes with a cortical ... the metacarpophalangeal joints, and many of the small carpal bones have irregular margins with indentations (for example, at the attachment of ligaments), making discriminati...

Ngày tải lên: 09/08/2014, 10:23

8 372 0
Báo cáo y học: "Suppression of bone morphogenetic protein inhibitors promotes osteogenic differentiation: therapeutic implications" doc

Báo cáo y học: "Suppression of bone morphogenetic protein inhibitors promotes osteogenic differentiation: therapeutic implications" doc

... or chordin - controls several BMPs (specifically BMP-2, -4 and -7 ) and therefore allows their natural synergy to regenerate bone in a physiological state. This takes advantage of the endogenous BMP cascade ... fracture healing. J Bone Miner Res 2002, 17:51 3-5 20. 3. Sakou T, Onishi T, Yamamoto T, Nagamine T, Sampath T, Ten Dijke P: Localization of Smads, the TGF-beta f...

Ngày tải lên: 09/08/2014, 10:23

2 166 0
Báo cáo y học: "Development of a health care utilisation data-based index for rheumatoid arthritis severity: a preliminary study" ppt

Báo cáo y học: "Development of a health care utilisation data-based index for rheumatoid arthritis severity: a preliminary study" ppt

... rheumatoid arthritis records-based index of severity (RARBIS) with and without medication sub-scale RARBIS with medication sub-scale RARBIS without medication sub-scale Claims-based variables Correlation ... How- ever, because the VA contains rich data from both medical record and health care utilisation databases, it is a unique and ideal data source for our analysis. Additional...

Ngày tải lên: 09/08/2014, 10:23

9 275 0
Báo cáo y học: "Development of daily rhythmicity in heart rate and locomotor activity in the human fetus" ppt

Báo cáo y học: "Development of daily rhythmicity in heart rate and locomotor activity in the human fetus" ppt

... "Decelera- tion" points to a decrease in compensatory mechanisms, while "zero-type" reaction is indicative of an unsatisfac- tory condition of the fetus. The analysis of 24-hour fetal ... Konstantinova NN: Disturbance of placental circulation and cardiac performance of the fetus (pathogenesis and theoret- ical prerequisites to early diagnosis and treatment)...

Ngày tải lên: 10/08/2014, 09:20

12 472 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles with each cycle consisting ... Detection of the JAK2V617F mutation by asymmetric PCR and melt curve analysis. Cancer Biomark 2007, 3:31 5-3 24. 23. Rapado I, Albizua E, Ayala R, Hernández JA,...

Ngày tải lên: 10/08/2014, 21:23

7 436 0
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx

Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx

... guidelines have been published in the UK and Australasia, specifically for medical practi- tioners for melanoma [6 0-6 2] but none are known to exist specifically for lesions arising on the foot. A review of ... strategy. A literature search was under- taken using the National Library of Medicine (NLM) PubMed database to identify literature on foot and nail melanoma. A...

Ngày tải lên: 10/08/2014, 21:24

4 404 0
Báo cáo y học: "Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pdf

Báo cáo y học: "Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pdf

... no association between plasmapheresis treatment and acute onset of facial neuropathy has been reported. Case presentation: A 35-year-old Caucasian man with no significant prior medical history ... immune-mediated acute polyneuropathy typically characterized by ascend- ing weakness and areflexia. An associatio n with Campy- lobacter jejuni infection is most common; however, numerous...

Ngày tải lên: 11/08/2014, 03:21

4 349 0
Báo cáo y học: "Development of a theory of implementation and integration: Normalization Process Theory" ppsx

Báo cáo y học: "Development of a theory of implementation and integration: Normalization Process Theory" ppsx

... make rational decisions about face validity, and to ask whether the NPM merited formal testing. This consisted of two main pieces of work, quantitative data analysis and research synthesis. Qualitative ... organization. We developed an applied theoretical model through analysis of empirical generalizations. Finally, we built a formal theory through a process of extension and impli...

Ngày tải lên: 11/08/2014, 05:21

9 441 0
w