... of treating neuropathic pain by inhibiting TLR4. Our results demonstrated that in- trathecal siRNA-mediated suppression of TLR4 attenuated CCI -induced mechanical allodynia and thermal hyperalgesia ... Department of Anesthesiology, Changhai Hospital, Second Military Medical University, Shanghai 200433, China 3. Institute of Thoracic Cardiac Surgery, Changhai Hospital, PLA, Shangh...
Ngày tải lên: 25/10/2012, 11:48
... 7. Naganuma Y, Tachimori H, Kawakami N, Takeshima T, Ono Y, Uda H, Hata Y, Nakane Y, Nakane H, Iwata N, et al.: Twelve-month use of mental health services in four areas in Japan: findings ... diagnosis of depression in primary care: a meta-analysis. Lancet 2009, 374:609-619. 23. Kawakami N, Takeshima T, Ono Y, Uda H, Hata Y, Nakane Y, Nakane H, Iwata N, Furukawa TA, Kik...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "EGb761 protects motoneurons against avulsion-induced oxidative stress in rats Research article" ppsx
... EGb761 protects motoneurons against avulsion -induced injury in rats. EGb761 protects motoneurons against avulsion -induced injury in rats. The neuroprotective effect of EGb761 against avulsion injury ... activity in injured C6-T1 spinal segments Root avulsion also resulted in a change in cNOS and iNOS activity in injured C6-T1 spinal segments. The activity of cN...
Ngày tải lên: 10/08/2014, 10:20
báo cáo hóa học: " Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines" docx
... C, and possibly via death cell receptors), action via cytochromes CYP 3A4 and CYP 1A2 stimulating the formation of metabolites, and finally action via the inhibition of Glutathione-S-transferase ... criigen@unicaen.fr 1 Laboratory of Biochemistry EA2608, Institute of Biology, University of Caen, France Full list of author information is available at the end of the article Gasnie...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt
... Chen 3 , Li Wang 4 1. Key Laboratory of Laboratory Medical Diagnostics, Ministry of Education, Department of Laboratory Medicine, Chong- qing Medical University, Chongqing 400016, China 2. Center ... before analyzed by SDS-PAGE and quantitated by using the BCA Protein Assay Kit (Be- yotime, Shanghai, China). 2.4 Immunizations Five-week old female BALB/c mice initially re- ceived...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo y học: "Partial protection against collagen antibody-induced arthritis in PARP-1 deficient mice" pps
... GCAGAGAGGAGGTTGACTTTC IL-6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTG MCP-1 CCACTCACCTGCTGCTACTCAT TGGTGATCCTCTTGTAGCCCTCC Ccl5 GTCGTGTTTGTCACTCGAAGGA TTGATGTATTCTTGAACCCACTTCTT iNOS CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGTTTCG COX-2 ... CATTGGAAGTGAAGCGTTTCG COX-2 GTGGAAAAACCTCGTCCAGA GCTCGGCTTCCAGTATTGAG β-Actin AGGTCATCACTATTGGCAACGA CACTTCATGATGGAATTGAATGTAGTT Open Access Available onl...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages" ppt
... the function of their target autoantigen [11]. A previous study of myositis autoantibody inhibition of autoantigen function found that all six of the anti-aminoacyl-tRNA synthetase antibodies that ... MC, Joffe MM, Plotz PH: Distinct seasonal patterns in the onset of adult idiopathic inflammatory myopathy in patients with anti- Jo-1 and anti-signal recognition particle aut...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Antiphospholipid reactivity against cardiolipin metabolites occurring during endothelial cell apoptosis" doc
... the interpretation of data. PC carried out the ELISA experiments and participated in the analysis of data. AL and TG carried out the immunoassay and participated in the analysis of data and in ... role of the fatty acyl chains in the binding of autoantibodies to lysophosphatidyleth- anolamine. Another study concluded that aPL binding as mon- itored with an ELISA system depen...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "RNA interference against polo-like kinase-1 in advanced non-small cell lung cancers" doc
... RNAi therapy against PLK-1 in a murine advanced lung cancer model Here we introduce an application of PLK-1 siRNA against an advanced l ung cancer. As described above, Kawata et al. Journal of ... 61:850-862. 14. Ochiya T, Takahama Y, Nagahara S, Sumita Y, Hisada A, Itoh H, Nagai Y, Terada M: New delivery system for plasmid DNA in vivo using atelocollagen as a carrier...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Simvastatin protects bladder and renal functions following spinal cord injury in rats." ppsx
... fixation. Images of bladders were scanned, and the area of the images was calculated using BioRad Quan- tity One 4.6.5 image analysis software. Urine analyses Animals were given abdominal massage ... muscularis layer of the bladder also regained its compact nature in simvastatin animals. Moreover, SCI -induced renal caspase-3 activity was significantly decreased in the simvastat...
Ngày tải lên: 11/08/2014, 03:20