Báo cáo y học: " Dimethylthiourea protects against chlorine induced changes in airway function in a murine model of irritant induced asthma" potx
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
... of treating neuropathic pain by inhibiting TLR4. Our results demonstrated that in- trathecal siRNA-mediated suppression of TLR4 attenuated CCI -induced mechanical allodynia and thermal hyperalgesia ... Department of Anesthesiology, Changhai Hospital, Second Military Medical University, Shanghai 200433, China 3. Institute of Thoracic Cardiac Surgery, Changhai Hospital, PLA, Shanghai 200433, China ... day before CCI surgery. Evaluation of tactile allodynia and thermal hyperalgesia The paw withdrawal latency (PWL) to radiant heat and paw withdrawal threshold (PWT) were used to evaluate...
- 9
- 487
- 0
Báo cáo y học: " Multiple barriers against successful care provision for depressed patients in general internal medicine in a Japanese rural hospital: a cross-sectional study" pot
... 7. Naganuma Y, Tachimori H, Kawakami N, Takeshima T, Ono Y, Uda H, Hata Y, Nakane Y, Nakane H, Iwata N, et al.: Twelve-month use of mental health services in four areas in Japan: findings ... diagnosis of depression in primary care: a meta-analysis. Lancet 2009, 374:609-619.23. Kawakami N, Takeshima T, Ono Y, Uda H, Hata Y, Nakane Y, Nakane H, Iwata N, Furukawa TA, Kikkawa T: Twelve-month ... minagaki@ncnp.go.jp1 Department of Psychogeriatrics, National Institute of Mental Health, National Center of Neurology and Psychiatry, Kodaira City, Tokyo, JapanFull list of author information...
- 9
- 326
- 0
Báo cáo y học: "EGb761 protects motoneurons against avulsion-induced oxidative stress in rats Research article" ppsx
... EGb761 protects motoneurons against avulsion -induced injury in rats. EGb761 protects motoneurons against avulsion -induced injury in rats. The neuroprotective effect of EGb761 against avulsion injury ... activity in injured C6-T1 spinal segmentsRoot avulsion also resulted in a change in cNOS andiNOS activity in injured C6-T1 spinal segments. Theactivity of cNOS gradually increased after spinal ... Ng YK, Gan P, Ling EA: Permanent occlusion of the middle cerebral artery upregulates expression of cytokines and neuronal nitric oxide synthase in the spinal cord and urinary bladder in the adult...
- 7
- 331
- 0
báo cáo hóa học: " Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines" docx
... C, and possibly via death cell receptors), action via cytochromes CYP 3A4 andCYP 1A2 stimulating the formation of metabolites, and finally action via the inhibition of Glutathione-S-transferase ... criigen@unicaen.fr1Laboratory of Biochemistry EA2608, Institute of Biology, University of Caen,FranceFull list of author information is available at the end of the articleGasnier et al. Journal of ... Fukuda K, Hibiya Y, Mutoh M, Koshiji M, Akao S, Fujiwara H: Inhibition of activator protein 1 activity by berberine in human hepatoma cells.Planta Medica 1999, 65:381-383.16. Janbaz KH, Gilani AH:...
- 13
- 184
- 0
Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt
... Chen3, Li Wang4 1. Key Laboratory of Laboratory Medical Diagnostics, Ministry of Education, Department of Laboratory Medicine, Chong-qing Medical University, Chongqing 400016, China 2. Center ... before analyzed by SDS-PAGE and quantitated by using the BCA Protein Assay Kit (Be-yotime, Shanghai, China). 2.4 Immunizations Five-week old female BALB/c mice initially re-ceived subcutaneous ... 5’-CGGGATCCATCGAAGGTCGTGAAGATTCGATGGACAT-3’, and 5’-CGCGCGACCGAGCGGAA GCTTCTATTTTCTTAAAGAGAC-3’. Underlined nucleotides represent the BamH I and Hind III site, respectively. PCR conditions included...
- 6
- 431
- 0
Báo cáo y học: "Partial protection against collagen antibody-induced arthritis in PARP-1 deficient mice" pps
... GCAGAGAGGAGGTTGACTTTCIL-6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTGMCP-1 CCACTCACCTGCTGCTACTCAT TGGTGATCCTCTTGTAGCCCTCCCcl5 GTCGTGTTTGTCACTCGAAGGA TTGATGTATTCTTGAACCCACTTCTTiNOS CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGTTTCGCOX-2 ... CATTGGAAGTGAAGCGTTTCGCOX-2 GTGGAAAAACCTCGTCCAGA GCTCGGCTTCCAGTATTGAGβ-Actin AGGTCATCACTATTGGCAACGA CACTTCATGATGGAATTGAATGTAGTTOpen AccessAvailable online http://arthritis-research.com/content/8/1/R14Page ... Santiago deCompostela.Collagen antibody -induced arthritis (CAIA) and clinical scoringCAIA was induced in 6-week-old male and female mice byintravenous injection on day 0 of 3 mg/mouse of...
- 9
- 270
- 0
Báo cáo y học: "Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages" ppt
... the function of their target autoantigen [11]. A previous study of myositis autoantibody inhibition of autoantigen function foundthat all six of the anti-aminoacyl-tRNA synthetase antibodiesthat ... MC,Joffe MM, Plotz PH: Distinct seasonal patterns in the onset of adult idiopathic inflammatory myopathy in patients with anti-Jo-1 and anti-signal recognition particle autoantibodies. Arthri-tis ... directed against SRP inhibit protein translocation into the ER in vitroHuman sera containing autoantibodies directed against SRP inhibit protein translocation into the ER in vitro. The secretory precursor...
- 13
- 261
- 0
Báo cáo y học: "Antiphospholipid reactivity against cardiolipin metabolites occurring during endothelial cell apoptosis" doc
... the interpretation of data. PC carried outthe ELISA experiments and participated in the analysis of data.AL and TG carried out the immunoassay and participated in the analysis of data and in ... role of the fatty acyl chains in the binding of autoantibodies to lysophosphatidyleth-anolamine. Another study concluded that aPL binding as mon-itored with an ELISA system depends on the fatty ... indicates healthy donors. (a) anticardiolipin reactivity; (b) antimonolysocardiolipin reactivity; (c) antidilysocardiolipin reactivity; (d) anti-hydrocardiolipin reactivity. The average immunoreactivities...
- 11
- 259
- 0
Báo cáo y học: "RNA interference against polo-like kinase-1 in advanced non-small cell lung cancers" doc
... RNAi therapy against PLK-1 in a murine advanced lung cancer model Here we introduce an application of PLK-1 siRNA against an advanced l ung cancer. As described above,Kawata et al. Journal of ... 61:850-862.14. Ochiya T, Takahama Y, Nagahara S, Sumita Y, Hisada A, Itoh H, Nagai Y, Terada M: New delivery system for plasmid DNA in vivo usingatelocollagen as a carrier material: the Minipellet. Nat Med1999,5:707-710.15.Song ... livermetastases of lung cancer. Mol Cancer Ther 2008, 7:2904-2912.52. Nogawa M, Yuasa T, Kimura S, Tanaka M, Kuroda J, Sato K, Yokota A, Segawa H, Toda Y, Kageyama S, et al: Intravesical administration...
- 6
- 322
- 0
Báo cáo y học: "Simvastatin protects bladder and renal functions following spinal cord injury in rats." ppsx
... fixation. Images of bladders were scanned, and the area of the images was calculated using BioRad Quan-tity One 4.6.5 image analysis software.Urine analysesAnimals were given abdominal massage ... muscularis layer of the bladder also regained its compact nature in simvastatin animals. Moreover, SCI -induced renal caspase-3 activity was significantly decreased in the simvastatin group indicating ... muscle hypertrophy. Rats treated with simvastatin for 14 days displayed remarkable recovery by showing decreased bladder size and maintenance of a normal urine/plasma osmolality ratio, in addition...
- 10
- 371
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam