Báo cáo y học: "Protective effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provocations with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study" ppsx

Báo cáo y học: "Protective effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provocations with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study" ppsx

Báo cáo y học: "Protective effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provocations with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study" ppsx

... effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provoca- tions with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study ... compared with formoterol alone, salbutamol and placebo. In addition all three active treatments significantly increased FEV 1 within 3 minut...

Ngày tải lên: 12/08/2014, 11:22

9 308 0
Báo cáo y học: " Protective effect of vasoactive intestinal peptide on bone destruction in the collagen-induced arthritis model of rheumatoid arthritis" pptx

Báo cáo y học: " Protective effect of vasoactive intestinal peptide on bone destruction in the collagen-induced arthritis model of rheumatoid arthritis" pptx

... vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide on osteoclast forma- tion are associated with upregulation of osteoprotegerin and downregulation of RANKL and RANK. ... (collagen- induced arthritis (CIA) [6] accompanied by infiltration of the synovial membrane and synovial cavity as well as by extensive local bone and cartilage destructi...

Ngày tải lên: 09/08/2014, 06:23

12 418 0
Báo cáo y học: "Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy" ppsx

Báo cáo y học: "Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy" ppsx

... -3' and 5'- TGCTCTAGATTAGAGAATGACAACATATGGATATTC -3'), Der p 2 (5'- CCGGAATTCGCCGCCACCATGGAT- CAAGTCGATGTCAAAGATTGTGCC -3' and 5'- TGCTCTAGATTAATCGCGGATTTTAGCATGAGTAG- CAAT ... CCGGAATTCGCCGCCACCAT- GGAAACAAGCGCTTGCCGTATCAATTCG -3' and 5'- TGCTCTAGATTAGAGGTTGTTTCCGGCTT- GGAAATATCCG -3'), Der f 2 (5'- CCGGAATTCGCCGCCACCATGGATCAAAGTCGATGT-...

Ngày tải lên: 13/08/2014, 13:22

9 297 0
Báo cáo y học: "Protective effect of resin adsorption on septic plasma-induced tubular injury" pdf

Báo cáo y học: "Protective effect of resin adsorption on septic plasma-induced tubular injury" pdf

... pathways in tubular cells via cas- pase activation and Fas up-regulation [8-10]. In addition, in experimental animal models of sepsis, a broad range of functional alterations of tubular re-absorption ... Santa Cruz Biotech, Santa Cruz, CA, USA). After incubation with primary antibodies, samples were washed with one times PBS and incubated with appro- priated Alexa Fluo...

Ngày tải lên: 13/08/2014, 20:21

14 196 0
Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf

Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf

... Fisher, A. , Fraser, R., Mc-Connell, J. & Davies, E. (2000) Amino acid residue 147 of human aldosterone synthase and 11beta- hydroxylase plays a key role in 11beta-hydroxylation. J. Clin. Endocrinol. ... (Mock) an d the c DNA o f b ovine Adx.Datashownaremeans±SEMoffourseparatetransfections, each done in duplicate. (B) Determination of 11b-hydroxylase capacity of CYP11B2 mut...

Ngày tải lên: 24/03/2014, 03:21

10 649 0
Báo cáo y học: "Different effect of exercise on left ventricular diastolic time and interventricular dyssynchrony in heart failure patients with and without left bundle branch block"

Báo cáo y học: "Different effect of exercise on left ventricular diastolic time and interventricular dyssynchrony in heart failure patients with and without left bundle branch block"

... stress in patients with wide QRS duration (20). In contrast, Kurita et al. reported on an increased mechanical dyssynchrony during pacing–induced tachycardia in patients with normal QRS duration ... cohort of patients evaluated in our hemodynamic laboratory. All of these patients had a normal left ventricular cavity size and baseline ejection fraction as eva...

Ngày tải lên: 05/11/2012, 11:32

8 868 1
Báo cáo khoa học: Protective effect of dietary curcumin and capsaicin on induced oxidation of low-density lipoprotein, iron-induced hepatotoxicity and carrageenan-induced inflammation in experimental rats ppt

Báo cáo khoa học: Protective effect of dietary curcumin and capsaicin on induced oxidation of low-density lipoprotein, iron-induced hepatotoxicity and carrageenan-induced inflammation in experimental rats ppt

... capsaicin and their combination on the damage caused to liver by iron overloading measured in terms of lipid peroxidation and elevation of plasma alanine aminotransferase (AlAT), aspartate aminotransferase (AsAT) ... curcumin, capsaicin and their combination on carrageenan induced in ammation To examine the postlocal anti -in ammatory potential of the combination of spice...

Ngày tải lên: 08/03/2014, 08:20

10 498 3
Báo cáo khoa học: Protective effect of active oxygen scavengers on protein degradation and photochemical function in photosystem I submembrane fractions during light stress pdf

Báo cáo khoa học: Protective effect of active oxygen scavengers on protein degradation and photochemical function in photosystem I submembrane fractions during light stress pdf

... such as histidine, DABCO, and n-propyl gallate, retarded the above damages to the antenna proteins indicating mainly 1 O 2 was involved [28]. In spinach thylakoids, illumination at low light intensity ... plastocyanin [31,32]. In the present study, the degradation of each polypeptide and the protein conformation changes are assessed in con- nection with alterations in photoche...

Ngày tải lên: 16/03/2014, 18:20

11 405 0
Báo cáo y học: "Class effect of pharmacotherapy in bipolar disorder: fact or misbelief" pptx

Báo cáo y học: "Class effect of pharmacotherapy in bipolar disorder: fact or misbelief" pptx

... They all concern acute mania and antipsycho- tics (FGAs and SGAs against acute mania and SGAs in maintenance protecting from m ania). Four effect cases are not adequately studied (FGAs against acute ... R, Walker D, Tran P, Breier A: A double-blind, randomized comparison of the efficacy and safety of intramuscular injections of olanzapine, lorazepam, or placebo in t...

Ngày tải lên: 09/08/2014, 01:21

9 478 0
w