Báo cáo y học: "Protective effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provocations with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study" ppsx

... effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provoca- tions with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study ... compared with formoterol alone, salbutamol and placebo. In addition all three active treatments significantly increased FEV 1 within 3 minut...

Ngày tải lên: 12/08/2014, 11:22

... vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide on osteoclast forma- tion are associated with upregulation of osteoprotegerin and downregulation of RANKL and RANK. ... (collagen- induced arthritis (CIA) [6] accompanied by infiltration of the synovial membrane and synovial cavity as well as by extensive local bone and cartilage destructi...

Ngày tải lên: 09/08/2014, 06:23

... -3' and 5'- TGCTCTAGATTAGAGAATGACAACATATGGATATTC -3'), Der p 2 (5'- CCGGAATTCGCCGCCACCATGGAT- CAAGTCGATGTCAAAGATTGTGCC -3' and 5'- TGCTCTAGATTAATCGCGGATTTTAGCATGAGTAG- CAAT ... CCGGAATTCGCCGCCACCAT- GGAAACAAGCGCTTGCCGTATCAATTCG -3' and 5'- TGCTCTAGATTAGAGGTTGTTTCCGGCTT- GGAAATATCCG -3'), Der f 2 (5'- CCGGAATTCGCCGCCACCATGGATCAAAGTCGATGT-...

Ngày tải lên: 13/08/2014, 13:22

... pathways in tubular cells via cas- pase activation and Fas up-regulation [8-10]. In addition, in experimental animal models of sepsis, a broad range of functional alterations of tubular re-absorption ... Santa Cruz Biotech, Santa Cruz, CA, USA). After incubation with primary antibodies, samples were washed with one times PBS and incubated with appro- priated Alexa Fluo...

Ngày tải lên: 13/08/2014, 20:21

... Fisher, A. , Fraser, R., Mc-Connell, J. & Davies, E. (2000) Amino acid residue 147 of human aldosterone synthase and 11beta- hydroxylase plays a key role in 11beta-hydroxylation. J. Clin. Endocrinol. ... (Mock) an d the c DNA o f b ovine Adx.Datashownaremeans±SEMoffourseparatetransfections, each done in duplicate. (B) Determination of 11b-hydroxylase capacity of CYP11B2 mut...

Ngày tải lên: 24/03/2014, 03:21

... stress in patients with wide QRS duration (20). In contrast, Kurita et al. reported on an increased mechanical dyssynchrony during pacing–induced tachycardia in patients with normal QRS duration ... cohort of patients evaluated in our hemodynamic laboratory. All of these patients had a normal left ventricular cavity size and baseline ejection fraction as eva...

Ngày tải lên: 05/11/2012, 11:32

... capsaicin and their combination on the damage caused to liver by iron overloading measured in terms of lipid peroxidation and elevation of plasma alanine aminotransferase (AlAT), aspartate aminotransferase (AsAT) ... curcumin, capsaicin and their combination on carrageenan induced in ammation To examine the postlocal anti -in ammatory potential of the combination of spice...

Ngày tải lên: 08/03/2014, 08:20

... such as histidine, DABCO, and n-propyl gallate, retarded the above damages to the antenna proteins indicating mainly 1 O 2 was involved [28]. In spinach thylakoids, illumination at low light intensity ... plastocyanin [31,32]. In the present study, the degradation of each polypeptide and the protein conformation changes are assessed in con- nection with alterations in photoche...

Ngày tải lên: 16/03/2014, 18:20

...

Ngày tải lên: 07/08/2014, 18:21

... They all concern acute mania and antipsycho- tics (FGAs and SGAs against acute mania and SGAs in maintenance protecting from m ania). Four effect cases are not adequately studied (FGAs against acute ... R, Walker D, Tran P, Breier A: A double-blind, randomized comparison of the efficacy and safety of intramuscular injections of olanzapine, lorazepam, or placebo in t...

Ngày tải lên: 09/08/2014, 01:21