Báo cáo y học: "Anxiety is associated with diminished exercise performance and quality of life in severe emphysema: a cross-sectional study" ppt

... variance in functional status and quality of life associated with COPD is not explained by mea- sures of pulmonary physiology. Psychological factors may play in important role in determining the impact ... increase in state anxi- ety score is associated with a mean decrease in 6 MWD of 9 meters, a decrease in maximum exercise workload of approximate...

Ngày tải lên: 12/08/2014, 11:20

... practices in pediatric ARV rollout and integration with early childhood programs in South Africa: A rapid situational analysis. (University of Cape Town School of Child and Adolescent Health and ... coping are important sources of psycho-social assistance. Across the four facilities, the training and repeat train- ing of health personnel (nurses and lay counsellors)...

Ngày tải lên: 10/08/2014, 05:22

... Domingo-Salvany A, Lamarca R, Ferrer M, Garcia-Aymerich J, Alonso J, Félez M, Khalaf A, Marrades RM, Monsó E, Serra-Batlles J, Antó JM: Health- related quality of life and mortality in male patients with ... of the patients. The study includedalargesampleofstableCOPDpatientswith mild to very severe disease, and had been designed as an ancillary study of the larger Phenot...

Ngày tải lên: 12/08/2014, 01:21

... characterized by elastolysis and collagenolysis and thus a dramatic loss of structural integrity. Remarkably, exceeding matrix deterioration was associated with massively increased levels of ... GM-CSF, a proinflammatory mediator and important regulator of the vascular collagen and elastin metabolism [5,6], was massively increased. In summary, our data suggest that the...

Ngày tải lên: 10/08/2014, 09:22

... CACTCGAGGTAGGTGTTTCTGCTAA tlr5 (rat) [NM_001145828] Forward GGGCAGCAGAAAGACGGTAT 61 60 Reverse CAGGCACCAGCCATCCTTAA tlr6 (rat) [NM_207604] Forward AGAACCTTACTCATGTCCCAAAAGAC 79 60 Reverse AGATCAGATATGGAGTTTTGAGACAGACT tlr7 ... predominantly at sites of attachment and invasion into cartilage and bone (open arrowheads). Staining specificity was assessed using isotype-matched antibodies as...

Ngày tải lên: 12/08/2014, 17:22

... testing using both HOMA-IR as a continuous variable and IR as a binary variable may be an issue. Whilst HOMA-IR may be considered more statistically valid, the use of IR as a binary variable is ... analysis. DS is the founder and principal investigator on the NOAR study. IB is the co-principal investigator and was instrumentally involved in study design, analysis and...

Ngày tải lên: 12/08/2014, 18:20

... estimate of ele vation of intracranial pres- sure, osmotherapy in the form of intravenous mannitol was administered, if available, deepening sedation and hyperventilation. Hyperglycemia and hypoglycemia ... found and associated with GCS score and mortality after TBI. Key messages • In patients with traumatic brain injury, plasma resistin level increased durin g the 6-h...

Ngày tải lên: 13/08/2014, 21:21

... Doulami * , Panagiotis G Drimousis, Andreas Larentzakis, Kostas Toutouzas and Stylianos Katsaragakis Abstract Introduction: Intramuscular myxoma is a rare benign soft tissue tumor. The lack of ... lower abdominal ultrasonography, colonoscopy and chest radiography did not reveal any pathology. An increase in CA 19.9 values has also been associated with hypothyroidism [12], but...

Ngày tải lên: 11/08/2014, 00:23

... Alobar holoprosencephaly with midline facial defects (hypo- telorism, arhinia, median cleft lip and palate) and bilat- eral auricular atresia are compatible with diabetic fetopathy. Interestingly, preaxial polydactyly ... This is the first report of associated ambiguous genital organ and bilateral adrenal hyperplasia in a case of diabetic fetopathy. Case presentation: A...

Ngày tải lên: 11/08/2014, 21:22

... contributions HV made the acquisition of data and part of the analysis of the data, and was also involved in drafting of the manuscript. AKL carried out the analysis and interpretation of mRNA data. RM made ... presented as mean ± standard error of the mean, n represents the number of independent experi- ments. Statistical analysis of data was made using a one-way an...

Ngày tải lên: 09/08/2014, 14:22