Báo cáo y học: "Anxiety is associated with diminished exercise performance and quality of life in severe emphysema: a cross-sectional study" ppt
Báo cáo y học: "Anxiety is associated with diminished exercise performance and quality of life in severe emphysema: a cross-sectional study" ppt
... variance in functional status and quality of life associated with COPD is not explained by mea-sures of pulmonary physiology. Psychological factorsmay play in important role in determining the impact ... increase in state anxi-ety score is associated with a mean decrease in 6 MWD of 9 meters, a decrease in maximum exercise workload of approximately 1 Watt, and an increase of approxi-mately 2 points ... participated in the design and coordination of the study, interpretation of data and writing the manuscript.AA and SKM participated in statistical analyses and writing the manuscript,VSF, ML and...
- 11
- 519
- 0
Báo cáo y học: "Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry" pptx
... practices in pediatric ARV rollout and integration with early childhood programs in South Africa: A rapid situational analysis. (University of Cape Town School of Child and Adolescent Health and ... coping areimportant sources of psycho-social assistance.Across the four facilities, the training and repeat train-ing of health personnel (nurses and lay counsellors) in quality HIV and infant ... Mental health is much-neglected in South Africagenerally, and particularly for women [38]. SouthAfrican women face conditions of poverty, genderinequality and social disadvantage. In addition...
- 9
- 404
- 0
báo cáo khoa học:" Factors affecting the relationship between psychological status and quality of life in COPD patients" potx
... Domingo-Salvany A, Lamarca R, Ferrer M, Garcia-Aymerich J, Alonso J,Félez M, Khalaf A, Marrades RM, Monsó E, Serra-Batlles J, Antó JM: Health-related quality of life and mortality in male patients with ... of the patients. The studyincludedalargesampleofstableCOPDpatientswithmild to very severe disease, and had been designed asan ancillary study of the larger Phenotype and Course of COPD (PAC-COPD) ... aspects of social function and psychological disturbances result-ing from respiratory disease. A score is calculated foreach domain and a total score is calculated. The scoresrange from 0 to 100 and...
- 9
- 409
- 0
Báo cáo y học: "Aortic dissection associated with cogans’s syndrome: deleterious loss of vascular structural integrity is associated with GM-CSF overstimulation in macrophages and smooth muscle cells" docx
... characterized by elastolysis and collagenolysis and thus a dramatic loss of structural integrity. Remarkably, exceeding matrix deterioration was associated with massivelyincreased levels of ... GM-CSF, a proinflammatory mediator and important regulator of the vascular collagen and elastin metabolism [5,6], was massively increased. In summary, our data suggest that the persistentlyincreased ... presentation: A 46-year-old female with Cogans’s syndrome and a history of arterial hypertension presented with severe chest pain caused by an aneurysm of the ascending aorta with a dissection...
- 5
- 376
- 0
Báo cáo y học: "Arthritis is associated with T-cell-induced upregulation of Toll-like receptor 3 on synovial fibroblasts" docx
... CACTCGAGGTAGGTGTTTCTGCTAAtlr5 (rat)[NM_001145828]Forward GGGCAGCAGAAAGACGGTAT 61 60Reverse CAGGCACCAGCCATCCTTAAtlr6 (rat)[NM_207604]Forward AGAACCTTACTCATGTCCCAAAAGAC 79 60Reverse AGATCAGATATGGAGTTTTGAGACAGACTtlr7 ... predominantly at sites of attachment and invasion into cartilage and bone (open arrowheads). Staining specificity wasassessed using isotype-matched antibodies as negative controls (right-hand image). ... at different time points by performing real-time PCR. Polyinosinic:polycytidylic acid (poly(I:C)) was intra-articularly administrated to PIA rats, and arthritis wasmonitored macroscopically...
- 15
- 325
- 0
Báo cáo y học: "Seropositivity is associated with insulin resistance in patients with early inflammatory polyarthritis: results from the Norfolk" pot
... testing using both HOMA-IR as a continuous variable and IR as a binary variable may be an issue. Whilst HOMA-IR may be considered more statistically valid, the use of IR as a binary variable is ... analysis. DS is the founder and principal investigator on the NOAR study. IB is the co-principal investigator and was instrumentally involved in study design, analysis and manuscript preparation. ... this manuscript. TF is the previous project lead and was involved in coordinating and supervising data collection, analysis and manuscript writing. SV is the project lead and has coordinated and...
- 20
- 308
- 0
Báo cáo y học: "Resistin is associated with mortality in patients with traumatic brain injury" ppt
... estimate of ele vation of intracranial pres-sure, osmotherapy in the form of intravenous mannitolwas administered, if available, deepening sedation and hyperventilation. Hyperglycemia and hypoglycemia ... found and associated with GCS score and mortality after TBI.Key messages• In patients with traumatic brain injury, plasma resistinlevel increased durin g the 6-hour period immediately,peaked within ... blood of patients with intracerebral hemorrhage and are associated with a poor outcome. However, not much is known regarding thechange in plasma resistin and its relation with mortality after traumatic...
- 5
- 341
- 0
Báo cáo y học: "Intramuscular myxoma associated with an increased carbohydrate antigen 19.9 level in a woman: a case report" pptx
... Doulami*, Panagiotis G Drimousis, Andreas Larentzakis,Kostas Toutouzas and Stylianos KatsaragakisAbstractIntroduction: Intramuscular myxoma is a rare benign soft tissue tumor. The lack of ... lower abdominal ultrasonography,colonoscopy and chest radiography did not reveal anypathology. An increase in CA 19.9 values has also been associated with hypothyroidism [12], but this elevationdoes ... Murphey M, McRae G, Fanburg-Smith J, Temple T, Levine A, Aboulafia A: Imaging of soft-tissue myxoma with emphasis on CT and MR and comparison of radiologic and pathologic findings. Radiology 2002,225(1):215-224.5....
- 4
- 385
- 0
Báo cáo y học: "Diabetic fetopathy associated with bilateral adrenal hyperplasia and ambiguous genitalia: a case report" ppsx
... Alobarholoprosencephaly with midline facial defects (hypo-telorism, arhinia, median cleft lip and palate) and bilat-eral auricular atresia are compatible with diabeticfetopathy. Interestingly, preaxial polydactyly ... This is the first report of associated ambiguous genital organ and bilateral adrenal hyperplasia in a case of diabetic fetopathy.Case presentation: A 19-year-old Thai primigravida with familial ... polydactyly whichhas been proposed as a marker of diabetic embryopathy.Adrenal hyperplasia with ambiguous genitalia was alsoidentified as an uncommon associated anomaly atautopsy.Competing...
- 4
- 304
- 0
Báo cáo y học: "Tumor necrosis factor alpha-dependent aggrecan cleavage and release of glycosaminoglycans in the meniscus is mediated by nitrous oxide-independent aggrecanase activity in vitro" pptx
... contributionsHV made the acquisition of data and part of the analysis of thedata, and was also involved in drafting of the manuscript. AKLcarried out the analysis and interpretation of mRNA data. RMmade ... presented as mean ± standard error of the mean, n represents the number of independent experi-ments. Statistical analysis of data was made using a one-wayanalysis of variance (ANOVA) indicating significant ... Poole AR: Enhanced cleavage of type II col-lagen by collagenases in osteoarthritic articular cartilage. JClin Invest 1997, 99:1534-1545.31. Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa...
- 9
- 426
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ