... Rap2. 6 were ampli- fied by RT-PCR using the primers Rap2. 4-S (ATGGCG- GATCTCTTCGGTG), Rap2. 4 -A (TCACGATAAAATTGAAGCCC), Rap2. 6-S (ATGGTGTC- TATGCTGACTAATG) and Rap2. 6 -A (GTTAGTTAAC- CAAAAGAGGAG), ... 2CPA translation start site was PCR amplified in five fragments using the primers AAACCATGGCATGCATAAGAGTC and TCCGGGAAATCCAGG for fragment 1, AAACCAT- GGCATGCATAAGAGTC and...
Ngày tải lên: 12/08/2014, 05:20
... site #4, 5¢-AGGGGAGAGGAGGG TTAAATTTGTGGGGGGTA CGAAAAGGCGG-3¢; (e) COX-2 promoter Ets site #5: 5¢-GGGTTTTTTACCCACG CTAATGAGAAAATCGGAA ACC-3¢. DNA transfection assays Cotransfections were carried out ... 22563– 22573. 15 Teruyama K, Abe M, Nakano T, Iwasaka-Yagi C, Takahashi S, Yamada S & Sato Y (2001) Role of tran- scription factor Ets-1 in the apoptosis of human vascular endotheli...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: The HNF1b transcription factor has several domains involved in nephrogenesis and partially rescues Pax8/lim1-induced kidney malformations docx
... 5¢-CGAGAGGTGGCGCAGCA GTTCAACCAGACAGTCCAG-3¢ (forwa rd), 5¢-CTCC CTGCCCTGCATGGGTGAACTCTGGAAAGAGAA AC-3¢ (reverse). 3 HNF1aabH and HNF1aabHS were generated by repla- cing the BamHI-XbaI fragment of HNF1aab with the BamHI-XbaI ... 1–321 aa of the human HNF 1a and 1–352 a a of the human HNF1b, respectively. A BamHI site was introduced both at G69 (a) andG79(b) without chang...
Ngày tải lên: 23/03/2014, 13:20
báo cáo khoa học: " The HaDREB2 transcription factor enhances basal thermotolerance and longevity of seeds through functional interaction with HaHSFA9" docx
... terminator sequences [35]. The primers used for PCR amplification were: 5'- TCTAGTAAAAATGGCACC-3' (HA-ATG) and 5'-CAAGAT- TCTACTTCTAGT-3' (HaDR2-3&apos ;A) . The amplification ... Concepción Almoguera - antolin@cica.es; Pilar Prieto-Dapena - ppdapena@irnase.csic.es; Juan Díaz- Martín - juan.diaz.exts@juntadeandalucia.es; José M Espinosa - jmespvaz@upo.es; Raúl Carran...
Ngày tải lên: 12/08/2014, 03:20
Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf
... Nakamura T, Takaki E, Hayashida N, Hai T & Nakai A (2007) Heat shock transcription factor 1 opens chromatin structure of interleukin-6 promoter to facilitate binding of an activator or a ... 9521–9528. 54 Takaki E, Fujimoto M, Sugahara K, Nakahari T, Yonemura S, Tanaka Y, Hayashida N, Inouye S, Takemoto T, Yamashita H et al. (2006) Maintenance of olfactory neurogenesis requi...
Ngày tải lên: 18/02/2014, 04:20
Báo cáo khoa học: Human mitochondrial transcription factor A possesses multiple subcellular targeting signals pptx
... Musicco C, Fracasso F, Milella F, Gadaleta MN, Gadaleta G & Cantatore P (2003) Acety- lation and level of mitochondrial transcription factor A in several organs of young and old rats. Biochem ... Mobile, AL, USA 2 Department of Mathematics and Statistics, University of South Alabama, Mobile, AL, USA 3 Institute of Molecular Biology and Genetics, Kyiv, Ukraine Mitoc...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: " The epidermal growth factor receptor (EGFR) in head and neck cancer: its role and treatment implications" pptx
... updated indi- vidual data. Lancet 2000, 355:949-955. 31. Budach W, Hehr T, Budach V, Belka C, Dietz K: A meta-analysis of hyperfractionated and accelerated radiotherapy and com- bined therapy and ... center's expertise. Although altered radiation fractionation and chemoradi- otherapy had a favorable impact for advanced head and neck cancer patients, the outcome of pat...
Ngày tải lên: 09/08/2014, 10:20
báo cáo khoa học: " Arabidopsis WRKY2 transcription factor mediates seed germination and postgermination arrest of development by abscisic acid" pdf
... important genes of the ABA signal pathway in the regulation of ger- mination and postgermination growth, we analyze whether abi3-1, abi5-1, aba2-3 and aba3-1 mutants have an effect on the expression ... show elevated expression of WRKY2 by ABA treatment requires ABA2 and ABA3. These results strongly suggest that ABI5, ABI3, ABA2 and ABA3 are important regulators of A...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo khoa học: The CssRS two-component regulatory system controls a general secretion stress response in Bacillus subtilis pdf
... (Syngene, Cambridge, UK) image acquisition system. Assays of enzyme activity For strains containing a transcriptional lacZ fusion, the b-galactosidase assay and the calculation of b-galactosidase units ... was exclusively elicited by translocated a- amylases, or also by a- amylase pre- cursors before their translocation across the mem- brane. Furthermore, it was not clear whet...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: "The 23S rRNA gene PCR-RFLP used for characterization of porcine intestinal spirochete isolates" pptx
...
Ngày tải lên: 07/08/2014, 18:21