báo cáo khoa học: " Phenotypic instability of Arabidopsis alleles affecting a disease Resistance gene cluster" ppt

... 5'-GCTTTTTAAGCCTTTGATCTTGAGAG-3', and 5'-NED-AGCACATTCCAGCAGATGTGGATCTCCAA-3' for Actin2. 5'-GCCGGATATGATCTTCGGAA-3', 5'- CGGCAAGCTCTTCAATCATG-3', and 5'-6FAM- TGGCCTAGTGAAGCA-3' ... arrows. R genes that are up-regulated in all three mutants are indicated by filled upward arrowheads. Additional R genes up-regulated in the bal variant are indi...

Ngày tải lên: 12/08/2014, 05:20

... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and the expansion of ... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually...

Ngày tải lên: 21/02/2014, 20:20

... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACAT...

Ngày tải lên: 18/02/2014, 06:20

... is an alpha-domain that associates as dimers in its crystal form. However, a careful inspection of the available molecular models for TRPs and OHCU decarboxylase domain indicates that allantoin ... this article as: Pessoa et al.: Functional characterization of Arabidopsis thaliana transthyretin-like protein. BMC Plant Biology 2010 10:30. Submit your next manuscript to BioMed Central a...

Ngày tải lên: 12/08/2014, 03:21

... full- length cDNA was amplified using two gene- specific prim- ers (5'-ATCGAATTCATGGACAATAGCAGAAC-3' and 5'- ATCCTCGAGTGAGGGCATAAACGAAT-3'). The ampli- fied DNA fragment was digested ... with two gene- specific primers (5'-ATCGAATTCATGGACAAT- AGCAGAAC-3' and 5'-ATCCCATGGTGGGCATAAAC- GAATCG-3'). The amplified fragment was digested with EcoR1 and Nco1 a...

Ngày tải lên: 12/08/2014, 05:20

... from an alternative initiation of translation with an inframe ATG located 78 bp down- stream of the first ATG. (B) Graphic representation of the results obtained in the REF assay expressed as percentage ... luciferase values were normalized to protein concentration as assessed by a Bradford assay. Protein preparation and western blotting analysis Protein preparation and western blottin...

Ngày tải lên: 18/02/2014, 16:20

... Analyzing, and Anima- ting Dynamical Systems. Society for Industrial and Applied Mathematics, Philadelphia. 54 Heinrich R, Rapoport SM & Rapoport TA (1977) Metabolic regulation and mathematical models. ... presence of noise, oscillatory behaviour is often recognized experimentally by a pair of charac- teristics: first, we look for fluctuations away from a steady state of reasonabl...

Ngày tải lên: 19/02/2014, 07:20

... (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAase...

Ngày tải lên: 19/02/2014, 12:20

... recorded at 25 °ConaJascoJ-810 spectropolarimeter (Jasco I nternational C o., L td, To kyo, Japan) available at the Central Instrumentation Labo ratory, University of Hyderabad. Spectra were recorded ... 2,6-toludinylnaphthalenesulfonic acid, auxins and cytokinins, to a variety of p lant lectins [ 40–44] and the binding of H 2 TPPS to human serum albumin and b-lactoglobulin at neutral...

Ngày tải lên: 19/02/2014, 16:20

... of Com- plex Nominals, Academic Press, New York, NY. Dan Moldovan, Adriana Badulescu, Marta Tatu, Daniel Antohe and Roxana Girju. 2004. Models for the Se- mantic Classification of Noun Phrases. ... pairs occur frequently in many languages, and the problem of semantic dis- ambiguation of these phrases has many potential applications in areas such as question-answering and machine...

Ngày tải lên: 20/02/2014, 12:20