báo cáo khoa học: " Phenotypic instability of Arabidopsis alleles affecting a disease Resistance gene cluster" ppt

... 5'-GCTTTTTAAGCCTTTGATCTTGAGAG-3', and5'-NED-AGCACATTCCAGCAGATGTGGATCTCCAA-3'for Actin2. 5'-GCCGGATATGATCTTCGGAA-3', 5'-CGGCAAGCTCTTCAATCATG-3', and 5'-6FAM-TGGCCTAGTGAAGCA-3' ... arrows. R genes that are up-regulated in all three mutants are indicated by filled upward arrowheads. Additional R genes up-regulated in the bal variant are indicated by open upward arrowheads ... mixture of transposable elements andtandemly arrayed paralogous genes that are targets of small RNA species. Genomic regions with this type of organization are frequent targets of epigenetic regulation[24,25]....

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and the expansion of ... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually infinite. Dynamic ... models are incomplete models that include only the information needed for an application and to which information can be added. Dynamic models are basically approximations of larger conventional...

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 ... and5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ (reverse) ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 (1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 (1)...

báo cáo khoa học: " Functional characterization of Arabidopsis thaliana transthyretin-like protein" potx

... is analpha-domain that associates as dimers in its crystalform. However, a careful inspection of the availablemolecular models for TRPs and OHCU decarboxylasedomain indicates that allantoin ... this article as: Pessoa et al.: Functional characterization of Arabidopsis thaliana transthyretin-like protein. BMC Plant Biology 201010:30.Submit your next manuscript to BioMed Centraland take ... column (GE Healthcare) was equilibratedwith buffer C at 0.5 ml/min and calibrated with proteinstandards of known Stokes radius. The Stokes radius (a) for the experimental data was calculated using:(-logKav)1/2=f (a) ....

báo cáo khoa học: " Functional analysis of Arabidopsis WRKY25 transcription factor in plant defense against Pseudomonas syringae" potx

... full-length cDNA was amplified using two gene- specific prim-ers (5'-ATCGAATTCATGGACAATAGCAGAAC-3' and 5'-ATCCTCGAGTGAGGGCATAAACGAAT-3'). The ampli-fied DNA fragment was digested ... withtwo gene- specific primers (5'-ATCGAATTCATGGACAAT-AGCAGAAC-3' and 5'-ATCCCATGGTGGGCATAAAC-GAATCG-3'). The amplified fragment was digested withEcoR1 and Nco1 and cloned ... border primer (5'-GCTTGCT-GCAACTCTCTCAG-3' for wrky25-1 and 5'-TAGCATCT-GAATTTCATAACCAATCTCGATACAC-3' for wrky25-2).The nature and locations of the T-DNA insertions wereconfirmed...

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... from an alternativeinitiation of translation with an inframe ATG located 78 bp down-stream of the ﬁrst ATG. (B) Graphic representation of the resultsobtained in the REF assay expressed as percentage ... luciferasevalues were normalized to protein concentration as assessedby a Bradford assay.Protein preparation and western blotting analysisProtein preparation and western blotting analysis ... Myc+Ras in the REF assay, this con-struct suppressed cotransformation activity at least as A BFig. 4. Common and distinct transcriptional effects of Mxi1-SRa and Mxi1-SRb on downstream target gene...

Tài liệu Báo cáo khoa học: Optimal observability of sustained stochastic competitive inhibition oscillations at organellar volumes pptx

... Analyzing, and Anima-ting Dynamical Systems. Society for Industrial andApplied Mathematics, Philadelphia.54 Heinrich R, Rapoport SM & Rapoport TA (1977)Metabolic regulation and mathematical models. ... presence of noise, oscillatory behaviouris often recognized experimentally by a pair of charac-teristics: ﬁrst, we look for ﬂuctuations away from a steady state of reasonable amplitude which appear ... Non-steady state nature of inhibition of milk xanthine oxidase by allopurinol and alloxanthineand of human erythrocytic adenosine deaminase bycoformycin. Biochem Pharmacol 24, 2187–2197.43 Cha...

Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

... (5¢ﬁ3¢)CorrespondingpeptideAS1 GGTTGCCTGAGRTGYATHTG a GCLRCICAS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATLAS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATLAS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTHanalyser.Synthesis of cDNATotal RNA was extracted using the RNeasy Mini Kit(Qiagen) according to the manufacturer’s instructions. Itwas treated with RNAase-free DNAase I (Pharmacia) ... lysozyme of the bivalve Tapes japonica [3], with the so-called chlamysin of Chlamys islandica [4,5], and also with a hypotheticalsecreted protein of the nematode Caenorhabditis elegans andwith putative...

Tài liệu Báo cáo khoa học: Thermodynamic analysis of porphyrin binding to Momordica charantia (bitter gourd) lectin pptx

... recorded at 25 °ConaJascoJ-810spectropolarimeter (Jasco I nternational C o., L td, To kyo,Japan) available at the Central Instrumentation Labo ratory,University of Hyderabad. Spectra were recorded ... 2,6-toludinylnaphthalenesulfonic acid,auxins and cytokinins, to a variety of p lant lectins [ 40–44]and the binding of H2TPPS to human serum albumin andb-lactoglobulin at neutral pH [45] are characterized byassociation ... toMomordica charantia(bitter gourd) lectinNabil A. M. Sultan, Bhaskar G. Maiya* and Musti J. SwamySchool of Chemistry, University of Hyderabad, IndiaOwing to the use of porphyrins in photodynamic...

Tài liệu Báo cáo khoa học: "Semantic Classification of Noun Phrases Using Web Counts and Learning Algorithms" ppt

... of Com-plex Nominals, Academic Press, New York, NY. Dan Moldovan, Adriana Badulescu, Marta Tatu, Daniel Antohe and Roxana Girju. 2004. Models for the Se-mantic Classification of Noun Phrases. ... pairs occur frequently in many languages, and the problem of semantic dis-ambiguation of these phrases has many potential applications in areas such as question-answering and machine translation. ... event in time and an entity in space. It may be that a combination of semantic information from an ontology and statis-tical information about paraphrases could be used together to achieve better...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật