báo cáo khoa học: " Co-expression and promoter content analyses assign a role in biotic and abiotic stress responses to plant natriuretic peptides" pptx
... and promoter content analyses assign a role in biotic and abiotic stress responses to plant natriuretic peptides Stuart Meier 1,3 , René Bastian 1 , Lara Donaldson 2 , Shane Murray 1 , Vladimir ... predict a function for AtPNP -A in plant abiotic and biotic stress responses, and in particular in systemic acquired resistance (SAR). Further...
Ngày tải lên: 12/08/2014, 05:20
... for Clinical Laborato- ries. Author Details National Center for Clinical Laboratories, Beijing Hospital, Beijing, PR China References 1. Balayan MS, Andjaparidze AG, Savinskaya SS, Ketiladze ES, ... of analytical results in the medical laboratory. Eur J Clin Chem Clin Biochem 1996, 34:983-999. 13. Koshy A, Grover S, Hyams KC, Shabrawy MA, Pacsa A, al-Nakib B, Zaidi SA, al-Anezi AA, al-...
Ngày tải lên: 12/08/2014, 04:20
... mutations within the B-Raf glycine-rich loop in colorectal tumors on mitogen-activated protein ⁄ extracellular signal-regulated kinase kinase ⁄ extracellular signal- regulated kinase and nuclear factor kappaB ... II; CREB, cAMP-response element binding protein; ERK, extracellular signal-regulated protein kinase; MAPK, mitogen-activated protein kinase; MSK1, mitogen and stress- activate...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf
... training data. For in- stance, a morphological analyzer may divide a four-character expression OO-SAKA-SHI-NAI into two words OO-SAKA (= Osaka) and SHI- NAI (= in the city), but the training data ... . According to this ordering, two candidates can have the same rank. One of them might assert that a certain word is an organization’s name and an- other candidate might assert th...
Ngày tải lên: 08/03/2014, 05:20
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt
... CGGGACGGTGTTGAGAGTGGA CXCL12.rv5 GAGAGTGGACCGGCACCAACA qCXCL12b.fw1 GAGGAGGACCACCATGCATCT qCXCL12b.rv1 TTGTGCAAGCAGTCCAGAAAGA Carp CXCL14 AJ536028 CXCL14.rv3 GGATGCAGGCAATACTCCTG CXCL14.fw5 CCATACTGCCAAGAAAAGATGAT qCXCL14.fw1 ... CAACAGGGAAAAGATGACACAGATC qACT.rv1 GGGACAGCACAGCCTGGAT Vector T7 TAATACGACTCACTATAGGG T3 CGCAATTAACCCTCACTAAAG Ó FEBS 2004 Three novel carp CXC chemokines (Eur. J. B...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: The HNF1b transcription factor has several domains involved in nephrogenesis and partially rescues Pax8/lim1-induced kidney malformations docx
... 5¢-CGAGA GGTGGCGCAGCAGTTCAACCAGACAGTCCAG-3¢ (forward), 5¢-GCCGCTCTAGATTAGCGCACTC-3¢ (re- verse); HNF1aaains26: 5¢-CGAGAGGTGGCGCAGCA GTTCAACCAGACAGTCCAG-3¢ (forwa rd), 5¢-CTCC CTGCCCTGCATGGGTGAACTCTGGAAAGAGAA AC-3¢ (reverse). 3 HNF1aabH and ... sequence using the following primers: HNF1aab: 5¢-GATGAGCTACCAACCAAGAA GATGCGCCGCA-3¢ (forward), 5 ¢-GCCGCTCTAGATT AGCGCACTC-3¢ (reverse); HNF1aabins...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: " Parsing the Wall Street Journal using a Lexical-Functional Grammar and Discriminative Estimation Techniques" doc
... Journal using a Lexical-Functional Grammar and Discriminative Estimation Techniques Stefan Riezler Tracy H. King Ronald M. Kaplan Palo Alto Research Center Palo Alto Research Center Palo Alto Research ... of Constraint-Based Grammars using Log-Linear Mea- sures and EM Training. In Proceedings of the 38th Annual Meeting of the Association for Computational Linguistics (ACL’00), Hong Ko...
Ngày tải lên: 23/03/2014, 20:20
Báo cáo khoa học: High-resolution crystal structures of the flavoprotein NrdI in oxidized and reduced states – an unusual flavodoxin pot
... with apoflavodoxin: a sensitive assay for riboflavin 5¢-phosphate and flavin adenine dinucleotide in mix- tures. Anal Biochem 68, 609–616. R. Johansson et al. NrdI – an unusual flavodoxin FEBS Journal ... FMN cofac- tor and the 40s loop. Residues within 4 A ˚ of FMN that make interactions with it are shown as thin lines. Particularly relevant side chains, including all acidic side chain...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx
... data of Group A and B were analyzed together; presenting irradiation of similar anatomical regions, while Group C was kept separated involving the sinonasal region only, and not the neck areas. Technical ... Switzerland. Authors’ contributions MS and AF coordinated the entire study. Patient accrual and clinical data collection was done by MS, SC, CB, MB, PN, SP. Data analysis, physi...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "The alkylphospholipid, perifosine, radiosensitizes prostate cancer cells both in vitro and in vivo" docx
... perifosine and the colony formation assay was conducted. Shown are the means and standard deviation of each individual treatment points. Figure S2: Perifosine and radiation induced apoptosis in PC-3 ... Guangzhou, China. 6 Department of Radiology and Radiation Oncology, Kitasato University School of Medicine, Sagamihara, Kanagawa, Japan. 7 Cancer Hospital, Chinese Academy of Medical...
Ngày tải lên: 09/08/2014, 09:20