báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

... using the following primers: LTA-1F, 5Â-CTCGAGATGGATAAAGTTTTAAACAGAG-3Â and LTA-1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCAGGGG-3Â ... long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and ... accessible method toexamine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ECs and their heterogeneity in various vascular beds. The early mortality...

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... Purandare AV, Chen Z, Huynh T, Pang S, Geng J,Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar-aman L (2008) Pyrazole inhibitors of coactivator associ-ated arginine methyltransferase 1 (CARM1). ... PRMTs catalyzemonomethylation as a reaction intermediate [4].Post-translational modiﬁcations within T -cell- recep-tor signaling cascades allow T lymphocytes to initiate a rapid and appropriate ... Lawson BR, Manenkova Y, Ahamed J, Chen X, ZouJP, Baccala R, Theoﬁlopoulos AN & Yuan C (2007)Inhibition of transmethylation down-regulates CD4T cell activation and curtails development of...

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 ... CCCGCTCGAGTCTTAGAATTATTGAGAACG3 GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 ... TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22...

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... buffer.P. Shahi et al. Thioesterase of Alcaligenes faecalis FEBS Journal 273 (2006) 23742387 ê 2006 IMTECH 2381 Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis Puja ... USA.Bacterial strainThe strain isolated from soil samples was identiﬁed as a bacterium, A. faecalis according to Bergey’s Manual [31],and was designated A. faecalis ISH108. The strain has ... that the physiologicalrole of thioesterase II in E. coli is to prevent theabnormal accumulation of intracellular acyl-CoA. We have isolated a thioesterase from Alcaligenes faecalis ISH108 and...

Báo cáo khoa học: "Development of a Stemming Algorithm" pdf

... sonal communication]) or mathematical analysis of a body of language, often require matched stems. (So does stemming as part of an information-retrieval sys- tem, the specific application ... of Chicago, Department of Lin- guistics. variety of applications are considered in evaluating the theoretical and practical attributes of several previous algorithms. As a major part of its ... derivational and inflectional suffixes. Researchers in many areas of computational linguistics and information retrieval find this a desirable step, but for varying reasons. In auto- mated...

Báo cáo khoa học: Development of a baculovirus-based ﬂuorescence resonance energy transfer assay for measuring protein–protein interaction potx

... intothe forward primer (5Â-CCTGTCAGATCTCCGCCATGGCTAACAATGCATCTCT-3Â), and a BamHI site(bold) was introduced into the reverse primer (5Â-TCTCCCGGATCCAAAGAGAAATACCCATA-TA-3Â) to facili-tate vector–insert ... University,Canberra, Australia A new baculovirus-based ﬂuorescence resonance energy transfer (Bv-FRET) assay for measuring multimerization of cell surface molecules in living cells is described. It has ... energy transfer assay for measuring protein–protein interaction Timothy C. Cheung and John P. HearnDevelopmental Biology Research Group, Research School of Biological Sciences, The Australian National...

Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx

... 337–343Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its applicationDeog Yong Lee, Young Wook Cho, Sang Gyun Kang, Sung Jae Shin, Han Sang Yoo*Department of Infectious ... interferon-gamma in response tomitogen, superantigen and recall viral antigen. Vet Immunol Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 343Immunopathol 1998, ... sanitary state of farms, pig sera wererandomly collected and concentration of IL-6 in the serawas measured with the antigen capture-ELISA. The capture-ELISA with the optimal concentration of...

Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx

... Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies 43washing, 100àl of each HRP conjugated MAb was addedinto each well and incubation ... sensitivityand specificity of the sandwich ELISA for screening Listeria spp. using different sets of flagella specific antibodycombinations.Materials and MethodsBacteria The 13 species of Listeria and ... incubation for 30 min at RT. After addingABTS (KPL, USA) and 30 min’s incubation at RT,absorbance was measured at 405 nm. Sandwich ELISA The sandwich ELISA was performed on microtiter plates.Each...

Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

... ...

Báo cáo khoa học: "Development of a monoclonal antibody-based co-agglutination test to detect enterotoxigenic Escherichia coli isolated from diarrheic neonatal calves" pptx

... ...

Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps

... articleDevelopment of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest standsGerhard Struck and Achim Dohrenbusch*Institute of Silviculture, Department ... plants ha –1 7455 plants ha –1 “wide spaced” ASIX – A new branch index 817as a raw material source. But we found no similar quo-tients to ASIX with the aim to describe tree quality.Categorical ... does a branch of certain diameter influence thetree quality of good and bad growing trees in the sameway? Certainly not. Due to this, there is a need of easily to measure parameters to describe...

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... is of Mexican origin. The index casewas a 23-year-old female diagnosed with breast carci-noma of the left breast with combined histological fea-tures of lobular carcinoma and infiltrating ... Journal of Surgical OncologyOpen AccessResearchIdentification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndromeLucia Taja-Chayeb*†1, Silvia Vidal-Millán†1, ... ductalcarcinoma. The family history suggested LFS: the patient'sfather was diagnosed with dorsal soft tissue leiomyosar-coma at the age of 67 years, and a half-sister (from the paternal...

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... (principal component analysis and isomap method)Brain plan evaluation for (a) ANFIS and (b) human planFigure 7Brain plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in (c). ANFIS ... TPS at the level of deliverable plansProstate plan evaluation for (a) ANFIS and (b) human planFigure 6Prostate plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in (c). ANFIS ... typically smaller for ANFIS-generatedplans (by an average of 7.4%). Comparing ANFIS andoFIS for the same cases, PTV coverage was somewhat infe-rior for ANFIS generated plans, although this was a minordifference...

Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx

... firstdemonstration of a monoclonal antibody, specificallydesigned to be reactive against multiple VEEV strains, Reactivity of phagemid clones to a wide range of VEEV strainsFigure 1 Reactivity of phagemid ... monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strainsLyn M O'Brien*, Cindy D Underwood-Fowler, Sarah A Goodchild, Amanda L Phelps and Robert ... antibody able to react with a wide range of VEEV strains whichwould have potential as an antiviral therapy for humanuse. Murine antibodies generally require molecularmanipulation to make them similar to...

báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf

... J,Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Taka-hashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M,Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T,Fujitsuka ... T,Fujitsuka N, Ito K, Kanamori H, Choi I, Nagamura Y, Matsumoto T,Murakami K, Matsubara K, Carninci P, Hayashizaki Y, Kikuchi S: Gene organization in rice revealed by full-length cDNA mappingand gene ... whole*2Lift ATCIS DescriptionACACAC 10 6056 1.353 PRHA BS in PAL1*3ATACACA 5 2124 1.929 PRHA BS in PAL1ATACACAC 3 739 3.326 PRHA BS in PAL1TACACAC 4 1786 1.835 PRHA BS in PAL1CATGTCTC 1 303...

Xem thêm