báo cáo khoa học: " Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blight" pptx

Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx

... splicing is important for ES cell self-renewal and differentiation[3]. However, the mechanisms by which molecules thatKeywords cell cycle; embryonic stem cells; knockout mouse; polypyrimidine tract-binding ... viable,they form compact colonies and exhibit severe defectsin cell proliferation without precocious differentiation.Our data clearly demonstrate that PTB is essential for mouse development and ES cell ... Furthermore, cell cycle analysis and a cell synchronization assayrevealed that Ptb) ⁄ )ES cells have a prolonged G2⁄ M phase. Thus, ourdata indicate that PTB is essential for early mouse development...

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris,France): 5forGulox (forward), 5Â-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3Â; and 3rev-Gulox (reverse), 5Â-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3Â. ... Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase Beata A. Wolucka1and David Communi21 Laboratory of Mycobacterial Biochemistry, ... (l-ascorbic acid; L-AA) is an importantmetabolite of plants and animals. It functions as anantioxidant (or pro-oxidant), an enzyme cofactor, aneffector of gene expression, and a modulator of react-ive...

Báo cáo khoa học: Two short protein domains are responsible for the nuclear localization of the mouse spermine oxidase l isoform pdf

... nuclear localization for the mSMOl isoform (Fig. 4).Taken together, these results consistently substanti-ate the hypothesis that these two structural regions are mandatory for the nuclear localization ... M. Bianchi et al.3054 FEBS Journal 272 (2005) 30523059 ê 2005 FEBS Two short protein domains are responsible for the nuclear localization of the mouse spermine oxidase l isoform Marzia Bianchi1, ... recently [10,11]. The subcellular localization of the catalytically activeisoforms mSMOa and mSMOl has been investigatedin the transiently and stably transfected murine neuro-blastoma cell line,...

Báo cáo khoa học: "Feature-Rich Part-of-speech Tagging for Morphologically Complex Languages: Application to Bulgarian" docx

... the wordform, OldEnd isthe string that has to be removed from the end ofthe wordform, and NewEnd is the string that has to be concatenated to the beginning of the word-form in order to produce ... Association for Computational Linguistics, pages 492–502,Avignon, France, April 23 - 27 2012.c2012 Association for Computational LinguisticsFeature-Rich Part-of-speech Tagging for Morphologically Complex ... (2005) decomposed the complex tags into factors, where models for pre-dicting part-of-speech, gender, number, case, andlemma are estimated separately, and then com-posed into a single CRF model;...

Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot

... member of aunique branch of the kinome in which downstream signaling occurs in bothligand- and receptor- expressing cells. Consequently, the ephrins and ephrin receptor tyrosine kinases often ... School of Medicine, New Haven, CT, USAIntroduction The ephrin receptor class of receptor tyrosine kinases (EPH RTKs) is the largest subgroup of RTKs in the kinome, and encodes a wide range of biological ... government works Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases Tara L. Davis1,2, John R. Walker1, Abdellah Allali-Hassani1, Sirlester A. Parker3,...

Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

... concom-itant appearance of inosine (Fig. 1A) . Incubation timeslonger than 30 min in the presence of H2O2did not greatlychange the ratio SATP + ADP + AMP/Ino. Similarchanges in ATP and inosine ... for 30 min, an important decrease in the ATP, and a less extensive decrease in the GTP, CTP, UTP and ADP-ribose levels was estimated. Concomitantly a net increase in the inosine levels was observed. ... H2O2evokes a decrease and an increase in the intracellularconcentration of ATP and inosine, respectively. Searchingfor the rationale for these phenomena, possible changes in the speciﬁc activities...

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

... 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line Sohel Ahmed, Masahiko Shibazaki, Takashi Takeuchi and Hideaki KikuchiDepartment of Molecular Genetics, ... molecular mechanism involved in the immunotoxicity of TCDD. In summary, we suggest that PKCh kinase activity is functionally involved in the TCDD-induced signal transduction mechanism leading to ... PKCh kinase activity is required in the pathway of TCDD-induced L-MAT cell apoptosis, weexamined the effect of a dominant negative PKCh (DNPKCh; a kinase- dead mutant, K ⁄ R 409) [22]. To separ-ate...

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

... enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme Masato Katsuyama*, Muhammer Ozgur Cevik*, Noriaki Arakawa, Tomoko Kakehi, ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy-agishi M, Taira K & Yabe-Nishimura C (2005) Essen-tial role of ATF-1 in induction of NOX1, a catalyticsubunit of NADPH oxidase: involvement of mitochon-drial ... mitochon-drial respiratory chain. Biochem J 386, 255–261.9 Fan C, Katsuyama M, Nishinaka T & Yabe-Nishimura C(2005) Transactivation of the EGF receptor and a PI3kinase-ATF-1 pathway is involved in...

Báo cáo khoa học: Active-site-speciﬁc chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors pptx

... MINIREVIEW Active-site-speciﬁc chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors Jian-Qiang Fan1 and Satoshi Ishii21 Department of Human Genetics, Mount Sinai School of Medicine, ... thedevelopment of ASSC therapy for Fabry disease. Par-ticularly, 1-deoxygalactonojirimycin (DGJ) is exploredas an example of the development of ASSC therapy. Structural basis of Fabry disease The ... for 140 days, indicating that DGJ is well toler-ated in mice.ASSC therapy for Fabry disease inhumansThe clinical proof -of- concept for ASSC therapy hasbeen investigated in cardiac Fabry disease...

Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx

... ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature Ajit K. Satapathy, Theetha L. Pavankumar, Sumana Bhattacharjya, Rajan ... Nonetheless, the present study identiﬁes the signiﬁcance of the RecD- associated ATPase activity required during the growth of P. syringae at low temperature (4 °C). The very low (but non-zero) ATPase ... this study for stim-ulation of ATPase and preparation of various helicasesubstrates for RecD. Table S2. Primers used in this study for cloning andmutagenesis of P. syringae recD. This material...

Báo cáo khoa học: DNA binding and partial nucleoid localization of the chloroplast stromal enzyme ferredoxin:sulﬁte reductase pptx

... studies of the role of SiR in chloroplast nucleoids, SiR was suggested to repress DNA synthesis[26] and transcription [27] within nucleoids. Relaxing the DNA compaction of nucleoids by release of ... repressionthan ZmSiR. Based on the results of the DNA- binding study, the tighter compaction of DNA induced byPsSiR was a result of its stronger binding to DNA. The results of immunoﬂuorescence microscopy ... syntheticdsDNA as a probe (Fig. 5A,B). Various amounts of recombinant PsSiR and 40-mer or 20-mer dsDNA weremixed, and then the mixtures were electrophoresed. The intensity of the shifted bands...

Báo cáo khoa học: Identiﬁcation of alternative promoter usage for the matrix Gla protein gene Evidence for differential expression during early development in Xenopus laevis doc

... al. Alternative promoter usage for Xenopus MGP gene FEBS Journal 272 (2005) 15011510 ê 2005 FEBS 1503 Identiﬁcation of alternative promoter usage for the matrix Gla protein gene Evidence for differential ... signa-ling plays a critical role in dorsoventral patterning andneural induction during early Xenopus development [32], the presence of MGP at these early stages sug-gests a role for this protein in ... arteries of mice lacking matrix Gla protein. Connect Tissue Res 44 (Suppl. 1), 272–278.6 Otawara Y & Price PA (1986) Developmental appear-ance of matrix GLA protein during calciﬁcation in the rat....

Báo cáo khoa học: "A Quantitative Evaluation of Linguistic Tests for the Automatic Prediction of Semantic Markedness" potx

... the mapping of the linguistic tests to comparisons of quantitative variables was in most cases straightfor- ward, and always at least plausible. The analysis of the linguistic tests and their ... models to perform badly. 8 Conclusions and Future Work We have presented a quantitative analysis of the per- formance of measurable linguistic tests for the selec- tion of the semantically ... properties of the words (number of different parts of speech). In fact, for these three variables, the hypothesis of ran- dom performance cannot be rejected even at the 5% level. Tests based on the...

Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot

... toRT-mix for synthesis of cDNA. The RT-mix consisted of 6àl of 5X Universal buffer, 3àl of 0.1àl M DDT, 1àl of 10mM dNTP, 1àl of reverse primer (20 pM), 1 of Superscript reverse transcriptase ... Seoul 151-742, KoreaOne step TaqMan reverse transcription polymerase chain reaction (RT-PCR) using TaqMan probe wasdeveloped for detection of Japanese encephalitis virus(JEV). Real-time RT-PCR ... sets for specificity (Fig. 1).Results showed that primer set of 3' NTR had good resultsbut the primer sets of prM and 5' NTR didn’t. Therefore,primers and probe of 3' NTR for the...

báo cáo khoa học: " Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blight" pptx

... potato does not result in lethality.However, the Sgt1 gene is essential for the RB-mediated late blight resistance. In contrast, the Rar1gene is not required for RB-mediated resistance. These results ... purposes)BMC Plant BiologyOpen AccessResearch article Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blightPudota B Bhaskar1, John A Raasch2, ... is to incorporate natural resistance into potato cultivars. Several late blight resistance genes have been cloned recently. However, there is almost no information available about the resistance...

Xem thêm