... splicing is important for ES cell self-renewal and differentiation [3]. However, the mechanisms by which molecules that Keywords cell cycle; embryonic stem cells; knockout mouse; polypyrimidine tract-binding ... viable, they form compact colonies and exhibit severe defects in cell proliferation without precocious differentiation. Our data clearly demonstrate that PTB...
Ngày tải lên: 07/03/2014, 00:20
... (Paris, France): 5forGulox (forward), 5Â-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3Â; and 3rev- Gulox (reverse), 5Â-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3Â. ... Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase Beata A. Wolucka 1 an...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Two short protein domains are responsible for the nuclear localization of the mouse spermine oxidase l isoform pdf
... nuclear localization for the mSMOl isoform (Fig. 4). Taken together, these results consistently substanti- ate the hypothesis that these two structural regions are mandatory for the nuclear localization ... M. Bianchi et al. 3054 FEBS Journal 272 (2005) 30523059 ê 2005 FEBS Two short protein domains are responsible for the nuclear localization of...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: "Feature-Rich Part-of-speech Tagging for Morphologically Complex Languages: Application to Bulgarian" docx
... the wordform, OldEnd is the string that has to be removed from the end of the wordform, and NewEnd is the string that has to be concatenated to the beginning of the word- form in order to produce ... Association for Computational Linguistics, pages 492–502, Avignon, France, April 23 - 27 2012. c 2012 Association for Computational Linguistics Feature-Rich Part-of-speech Tagging...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot
... member of a unique branch of the kinome in which downstream signaling occurs in both ligand- and receptor- expressing cells. Consequently, the ephrins and ephrin receptor tyrosine kinases often ... School of Medicine, New Haven, CT, USA Introduction The ephrin receptor class of receptor tyrosine kinases (EPH RTKs) is the largest subgroup of RTKs in the k...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot
... concom- itant appearance of inosine (Fig. 1A) . Incubation times longer than 30 min in the presence of H 2 O 2 did not greatly change the ratio SATP + ADP + AMP/Ino. Similar changes in ATP and inosine ... for 30 min, an important decrease in the ATP, and a less extensive decrease in the GTP, CTP, UTP and ADP-ribose levels was estimated. Concomitantly...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... 2,3,7,8- tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line Sohel Ahmed, Masahiko Shibazaki, Takashi Takeuchi and Hideaki Kikuchi Department of Molecular Genetics, ... molecular mechanism involved in the immunotoxicity of TCDD. In summary, we suggest that PKCh kinase activity i...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt
... enhancer factor 2B is involved in the inducible expression of NOX1 ⁄ NADPH oxidase, a vascular superoxide-producing enzyme Masato Katsuyama*, Muhammer Ozgur Cevik*, Noriaki Arakawa, Tomoko Kakehi, ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy- agishi M, Taira K & Yabe-Nishimura C (2005) Essen- tial role of ATF-1 in induction of NOX1, a catalyt...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: Active-site-specific chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors pptx
... MINIREVIEW Active-site-specific chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors Jian-Qiang Fan 1 and Satoshi Ishii 2 1 Department of Human Genetics, Mount Sinai School of Medicine, ... the development of ASSC therapy for Fabry disease. Par- ticularly, 1-deoxygalactonojirimycin (DGJ) is explored as an example of the development of...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx
... ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature Ajit K. Satapathy, Theetha L. Pavankumar, Sumana Bhattacharjya, Rajan ... Nonetheless, the present study identifies the significance of the RecD- associated ATPase activity required during the growth of P. syringae at low temp...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: DNA binding and partial nucleoid localization of the chloroplast stromal enzyme ferredoxin:sulfite reductase pptx
... studies of the role of SiR in chloroplast nucleoids, SiR was suggested to repress DNA synthesis [26] and transcription [27] within nucleoids. Relaxing the DNA compaction of nucleoids by release of ... repression than ZmSiR. Based on the results of the DNA- binding study, the tighter compaction of DNA induced by PsSiR was a result of its stronger binding...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: Identification of alternative promoter usage for the matrix Gla protein gene Evidence for differential expression during early development in Xenopus laevis doc
... al. Alternative promoter usage for Xenopus MGP gene FEBS Journal 272 (2005) 15011510 ê 2005 FEBS 1503 Identification of alternative promoter usage for the matrix Gla protein gene Evidence for differential ... signa- ling plays a critical role in dorsoventral patterning and neural induction during early Xenopus development [32], the presence...
Ngày tải lên: 30/03/2014, 16:20
Báo cáo khoa học: "A Quantitative Evaluation of Linguistic Tests for the Automatic Prediction of Semantic Markedness" potx
... the mapping of the linguistic tests to comparisons of quantitative variables was in most cases straightfor- ward, and always at least plausible. The analysis of the linguistic tests and their ... models to perform badly. 8 Conclusions and Future Work We have presented a quantitative analysis of the per- formance of measurable linguistic tests for t...
Ngày tải lên: 31/03/2014, 06:20
Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot
... to RT-mix for synthesis of cDNA. The RT-mix consisted of 6 à l of 5X Universal buffer, 3 à l of 0.1 à l M DDT, 1 à l of 10 mM dNTP, 1 à l of reverse primer (20 pM), 1 of Superscript reverse transcriptase ... Seoul 151-742, Korea One step TaqMan reverse transcription polymerase chain reaction (RT-PCR) using TaqMan probe was developed for detection of Japa...
Ngày tải lên: 07/08/2014, 18:20
báo cáo khoa học: " Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blight" pptx
... potato does not result in lethality. However, the Sgt1 gene is essential for the RB-mediated late blight resistance. In contrast, the Rar1 gene is not required for RB-mediated resistance. These results ... purposes) BMC Plant Biology Open Access Research article Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance...
Ngày tải lên: 12/08/2014, 05:20