báo cáo khoa học: " Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level" ppsx

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specifici...

Ngày tải lên: 14/02/2014, 14:20

... 20 10 FEBS The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3Â UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines ... activator and urokinase-type plasminogen activator are controlled by plasminogen activator inhibitor types 1 and 2 (PAI-1...

Ngày tải lên: 16/02/2014, 09:20

... short interfering RNA (siRNA) in human cells. Both HO-2 mRNA and protein are expressed in the eight human cancer cell lines examined, and HO-1 expression is detectable in five of the cell lines, including ... resetting of HO-1 expression. In contrast with HO-1 expression, expression of HO-2 mRNA and protein was not increased in several human cell...

Ngày tải lên: 19/02/2014, 05:20

... termed ambiguous and its presence in a particular consonant c of a language l indicates that the speakers of l are unable to make a distinc- tion as to whether c is articulated with the tongue against ... 601–608. J. R. Quinlan. 1993. C4.5: Programs for Machine Learning. Morgan Kaufmann. S. V. Shanmugam. 1972. Dental and alveolar nasals in Dravidian. In Bulletin of th...

Ngày tải lên: 22/02/2014, 02:20

... Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid Yang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria Selmer Department of Cell and Molecular Biology, ... Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, an...

Ngày tải lên: 06/03/2014, 22:21

... dissociation of the axial ligand no longer occurs. The present study addresses the effect on structure and unfolding upon replacing the axial Met ligand with a Lys in the M100K variant of cyt c-550 ... al. X-ray and unfolding studies of cyt c-550 FEBS Journal 272 (2005) 24412455 ê 2005 FEBS 2455 The effect of replacing the axial me...

Ngày tải lên: 07/03/2014, 17:20

... 2006) doi:10.1111/j.1742-4658.2006.05203.x We analyzed the role of gangliosides in the association of the ErbB2 recep- tor tyrosine-kinase (RTK) with lipid rafts in mammary epithelial HC11 cells. Scanning confocal microscopy ... regu- late the function of ErbB2 (heterodimerization, signa- ling and metabolic fate) [10]. We therefore analyzed the role...

Ngày tải lên: 23/03/2014, 10:21

... regulatory mechanism of MIG6 in relation to the EGFR mutation. The present study is the first to show the association of MIG6 expression with the EGFR mutation in cancer. MIG6 ⁄ RALT is known to be ... 0.05. EGFR mutation and MIG6 expression T. Nagashima et al. 5244 FEBS Journal 276 (2009) 52395251 ê 2009 The Authors Journal compilation ê 2009 FEBS Mutation of...

Ngày tải lên: 30/03/2014, 01:20

... Original article Wood density traits in Norway spruce understorey: effects of growth rate and birch shelterwood density Göran Bergqvist SLU, Department of Silviculture, 90183 ... [14]. Following clear-felling and prescribed burn- ing in 1930, the stand was regenerated by direct seeding of Norway spruce (Picea abies (L.) Karst.) and...

Ngày tải lên: 08/08/2014, 14:21

... Cytokines and bone loss in a 5-year longitudinal study — hormone replacement therapy suppresses serum soluble interleukin-6 receptor and increases interleukin-1- receptor antagonist: the Danish ... Baylink DJ, af Ekenstam E, Lindh E, Mohan S, Ljunghall S: Circulating levels of insulin-like growth factor- I and -II, and IGF- binding protein-3 in inflammation a...

Ngày tải lên: 09/08/2014, 01:21

... histolo- gical type of carcinoma associated with ulcerative colitis is adenocarcinoma [2]. We present a case of primary rectal small cell carcinoma in a patient with a history of ulcerative colitis, ... [4]. In our case, the small cell carcinoma was of the undifferen- tiated type. Figure 3 Small cell carcinoma with invasion of the mucosa (H+E ì100). Figure 4...

Ngày tải lên: 09/08/2014, 03:23

... 20) and interday (n = 200) coefficients of variance for each biomarker were, respectively: for C2C, 10 – 17 % and 14 %; for C1,2C, 5 14 % and 13 %; for CS 846 - epitope, 4 12 % and 12 %; and for CPII, 11 18 % ... differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis SM...

Ngày tải lên: 09/08/2014, 07:20

... enhances effector T cell responses in tumour draining lymph nodes [27]. Recent data also indicated that the presence of Foxp3+ T cells in tumour draining lymph nodes of colorectal cancer patients correlated ... this article as: Kemp et al.: T cell subpopulations in lymph nodes may not be predictive of patient outcome in colorectal cancer. Journa...

Ngày tải lên: 10/08/2014, 10:21

... 10:9 http://www.biomedcentral.com/1471-244X/10/9 Page 9 of 9 RESEARC H ARTIC L E Open Access Excessive substance use in bipolar disorder is associated with impaired functioning rather than clinical characteristics, a descriptive study Trine ... bipolar disorder is associated with impaired functioning rather than clinical characteristics,...

Ngày tải lên: 11/08/2014, 16:22

... for citation purposes) BMC Plant Biology Open Access Research article Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level Paul ... normal cell elongation in Arabidopsis hypocotyls. When the average DE% falls below this level, as in two gibberellic acid (GA) mutants ga1-3 and gai, and pla...

Ngày tải lên: 12/08/2014, 05:20