báo cáo khoa học: " Impact of AtNHX1, a vacuolar Na+/H+ antiporter, upon gene expression during short- and long-term salt stress in Arabidopsis thaliana" doc
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... wasresponsible for conceiving the study, data acquisition, analysis of the data, statistical analysis and drafting of the manuscript.BC was responsible for data acquisition, analysis of the data,and ... the unnoticed changing of an already activated prescription of a continuous infusion medication. Since recent upgrading of the system every continuous infusion prescription changebecomes immediately visible ... prescription error was validated by a clinicalpharmacist. The registration of different classes of MPE wasdone according to the National Coordinating Council for Medication Error Reporting and Prevention...
- 9
- 738
- 1
Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx
... intervention within the biosyntheticpathway of ADAM10 is provided by directly interfer-ing with the expression of the gene for ADAM10: the promoter region of the gene for ADAM10 has beencharacterized ... 15851596 ê 2010 The Authors Journal compilation ê 2010 FEBS REVIEW ARTICLE Upregulation of the a-secretase ADAM10 – risk or reason for hope? Kristina Endres and Falk FahrenholzDepartment of Psychiatry ... available for activating the correspondingnuclear receptors. In the case of ADAM10 regulation,cell culture studies with a variety of ligands for nuclearreceptors narrowed the receptors involved...
- 12
- 591
- 0
Tài liệu Báo cáo khoa học: Impact of the native-state stability of human lysozyme variants on protein secretion by Pichia pastoris doc
... Journal compilation ê 2006 FEBS 715 Impact of the native-state stability of human lysozyme variants on protein secretion by Pichia pastoris Janet R. Kumita1, Russell J. K. Johnson1, Marcos ... secretion levels of 10 lysozyme variants shows that the low yields of these secreted proteins, under controlled conditions, canbe directly correlated with a reduction in the thermostability of their ... wedemonstrate a clear relationship between the levels of protein secreted from P. pastoris and the native-state thermostability of the lysozyme variants, a finding thathas implications for the onset...
- 10
- 577
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... its interaction with PAP I. Alternat-ively, it is also possible that PAP I stimulation of poly(A) synthesis is correlated with the ATPase activ-ity of Hfq [25].M. Folichon et al. Hfq binding ... elongation by PAP I FEBS Journal 272 (2005) 454463 ê 2004 FEBS 459 Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails Marc Folichon, ... The position of the AU rich region at the 5Â end is not critical for Hfq binding The idea that stimulation of poly(A) synthesis is cor-related with the association of Hfq to the 3Â end of RNA...
- 10
- 488
- 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... HeLa cells was similar (3.0 ± 1.1) to that A BCshifted123123456bandProbe1.00E+008AAAGAGATGAAGGACATGAAAGACCTGAAAGACATGKd=1.2 nMAAAGAGATGKd=0.29 nMAAAGACACGKd=4 nMAAAGACACGAAAGACATAAGAGACATGAAAGACATGAAAGCCATGAAATACATG8.00E+0076.00E+0074.00E+0072.00E+0070.00E+000141612108Fluoriscence340Fluoriscence340640.00 ... mutants. ND, not determined. Sequence EMSAFluorescence quenchingResult Average Kd(nM)AAAGACATG + + 0.25 A GAGACATG ND –AAGGACATG ND –AAATACATG ––AAAGCCATG ––AAAGAGATG + + 1.5AAAGACCTG ... weresynthesized (IDT, Coralville, IA, USA). In addition, oligo-nucleotides, namely A GAGACATG (P2), AAGGACATG(P3), AAATACATG (P4), AAAGCCATG (P5), AAAGAGATG (P6), AAAGACCTG (P7), AAAGACACG(P8),...
- 14
- 393
- 0
![Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot](https://media.store123doc.com/images/document/14/rc/ld/small_ldo1394248806.jpg)
Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot
... Membrane -reconstituted human CYP1A1 (Eur. J. Biochem. 269) 1805 PRIORITY PAPER Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity ... correlation between the activation of the CYP1A1- catalyzed epoxidation reaction of 7,8-diols a nd the enhanced nonbilayer phase propensi ty in membranes containing PtdEtn.Effect of lipids on the stereoselectivity ... that in addition to the membrane charge, the nonbilayer phase propensity of the membrane is animportant determinant for an effective reconstitution of CYP1A1- dependent epoxidation activity. The...
- 7
- 376
- 0
Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf
... E. coli and cause diarrhea in domestic animals. In manyrespects, the roles of the FaeB and FanB proteins in transcriptional regulation are similar to that of PapB in the regulation of the pap ... elisabeth.sauer-eriksson@chem.umu.se;bernt.eric.uhlin@molbiol.umu.seDatabaseThe atomic coordinates and structure factors for the Escherichia coli FocB protein are available in the Protein DataBank database under the accession number3M8J(Received ... transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli Ulrika W. Hultdin1, Stina Lindberg2, Christin Grundstroăm1, Shenghua Huang1, Bernt Eric Uhlin2and A. Elisabeth...
- 14
- 459
- 0
Báo cáo khoa học: Characterization of scorpion a-like toxin group using two new toxins from the scorpion Leiurus quinquestriatus hebraeus doc
... Purification of the toxins Lqh6 (A) and Lqh7 (B) from the venom of the scorpion Leiurus quinquestriatus hebraeus (Lqh).Fig. S2. Amino acid sequences of toxins Lqh6 and Lqh7.Ó FEBS 2002 Two new a-like toxins ... characterization of two new toxins, desig-nated Lqh6 and Lqh7, from the venom of the yellow scorpion Leiurus quinquestriatus hebraeus and showthat bothrepresent new members of the a-like group. In ... pharmacological properties of the new toxins are compared to those of other scorpion a -toxins in order tore-examine the hallmarks previously set for the a-like toxin group. Keywords: scorpion toxin; sodium...
- 14
- 380
- 0
Báo cáo khoa học: Association of RNA with the uracil-DNA-degrading factor has major conformational effects and is potentially involved in protein folding pot
... are in excel-lent agreement with the hypothesis of the two confor-mational states presented in Fig. 4, and are also in line with the findings of the thermal unfolding and CDstudies. RNA binding ... an intrinsic relationship between the RNA binding and protein folding in RNA UDE.Interestingly, treatment of RNA UDE with RNa- se A did not result in significant changes of the meltingcurve, indicating ... Journal compilation ê 2010 FEBS Association of RNA with the uracil-DNA-degrading factor has major conformational effects and is potentially involved in protein folding Angela Bekesi1, Maria Pukancsik1,...
- 21
- 465
- 0
Báo cáo khoa học: Biosynthesis of isoprenoids A bifunctional IspDF enzyme fromCampylobacter jejuni pot
... proteins of E. coliand Plasmodium falciparum. Comparative genomic analysisshow that all sequenced a- ande-proteobacteria have fused ispDF genes. These bifunctional proteins a re potential drugtargets ... tructureformulas, the13C labels are indicated b y filledsquares and ba rs connecting adjacent13Catoms.Table 3. Activation of the catalytic domains of recombinant IspDF protein by divalent metal ions. ... ACGCATATGAGTGAAATGAGCCTTATTATGTTA IspDF Reverse GCTGGATCCTCATAATCTTGTCCAATCAAAATAFig. 1. Deoxyxylulose phosphate pathway for the biosynthesis of isoprenoids. Ó FEBS 2004 The bifunctional enzyme IspDF (Eur. J....
- 8
- 305
- 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
... residues of the protein (assumedtobe140) ,A 90°is the absorption with the 90 °polarizer, and S are order parameters calculated from the ratio of the parallel and perpendicular absorption bands. SLis ... humanfibrosarcoma and MCF 7 from human breast adenocarci-noma, were obtained from the Istituto ZooprofilatticoSperimentale della Lombardia e dell’Emilia, Brescia, Italy.Lipids. A series of natural and ... and the hemolytic assay wasperformed as described above. The appearance of lipid hydrolytic products of ammodytin I2, i.e. lysophospholipids and fatty acids, was confirmed by standard TLC and electrospray...
- 12
- 492
- 0
báo cáo khoa học: " Impact of welfare cheque issue days on a service for those intoxicated in public" pptx
... intoxicated, in Vancouver, Canada. Data on 1234 consecutive admissions to the SUover a 7-month period were assessed, and the average number of daily admissions on each of the7 days of the welfare ... CentralPage 1 of 4(page number not for citation purposes)Harm Reduction JournalOpen AccessBrief report Impact of welfare cheque issue days on a service for those intoxicated in publicXin ... in morbidityand mortality [6], an increase in hospital inpatients leav-ing a specialized HIV inpatient ward AMA [7] and a decrease in occupancy rate to a medical withdrawal man-agement [8].This...
- 4
- 277
- 0
báo cáo khoa học:" Impact of osteoporosis and vertebral fractures on quality-of-life. a population-based study in Valencia, Spain (The FRAVO Study)" pptx
... Sanfélix-Genovés et al.: Impact of osteoporosis and vertebral fractures on quality -of- life. a population-based study in Valencia, Spain (The FRAVO Study) . Health and Quality of Life Outcomes2011 ... Investigación en Salud Pública (CSISP), Valencia, Spain. 2Centro de Salud de Nazaret, Agencia Valenciana de la Salud. Valencia, Spain. 3Centro de Salud de Villamarchante, Agencia Valenciana de la ... Rebollar A, Gómez Alonso C, DíazCorte C, Cannata And a J: Effect of vertebral fracture on health relatedquality of life in a Spanish population older than 54 years [in Spanish].Med Clin (Barc)...
- 10
- 465
- 0
báo cáo khoa học:" Impact of dizziness on everyday life in older primary care patients: a cross-sectional study" potx
... N, Garmendia I, Garcia-Granero M, Martin E, Garcia-Tapia R: Factoranalysis and correlation between Dizziness Handicap Inventory and Dizziness Characteristics and Impact on Quality of Life scales. ... with walking and/or (almost) falling 57 .46 2.3 .47 0.4 3.0 (2.0-4.5)Table 3 Association of all candidate indicators with the impact of dizziness on everyday life in older primary care patientsPrev, ... and additional examination, previously selected by an international expertpanel and based on an earlier systematic review. Our primary outcome was impact of dizziness on everyday life measured...
- 7
- 403
- 0
báo cáo khoa học: " Impact of AtNHX1, a vacuolar Na+/H+ antiporter, upon gene expression during short- and long-term salt stress in Arabidopsis thaliana" doc
... BiologyOpen AccessResearch article Impact of AtNHX1, a vacuolar Na+/H+ antiporter, upon gene expression during short- and long-term salt stress in Arabidopsis thalianaJordan B Sottosanto, Yehoshua ... salinity and oxidative stress in Arabidopsis [49,50]. Also a rice homologue of this gene was differentially regulatedby both ABA and salinity and was implicated in vesiculartraffic to the vacuole ... Yehoshua Saranga - saranga@agri.huji.ac.il; Eduardo Blumwald* - eblumwald@ucdavis.edu* Corresponding author AbstractBackground: AtNHX1, the most abundant vacuolar Na+/H+ antiporter in Arabidopsis...
- 15
- 330
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM