báo cáo khoa học: " Identification of amino acid residues involved in substrate specificity of plant acyl-ACP thioesterases using a bioinformatics-guided approach" pptx

báo cáo khoa học: " Identification of amino acid residues involved in substrate specificity of plant acyl-ACP thioesterases using a bioinformatics-guided approach" pptx

báo cáo khoa học: " Identification of amino acid residues involved in substrate specificity of plant acyl-ACP thioesterases using a bioinformatics-guided approach" pptx

... CCAAGCAATCCAGCAGTCTG AACATGATTA VTF GATATGGGTTACT ACTCGTATGC VTR GCATACGAGT AGTAACCCATATC MTF GGAAAGAATGGTACT CGTCGTGATTGGCT MTR AGCCAATCACGACGAGT ACCATTCTTTCC SQF TGACTCGCCGGCTGCAG AAGCTGCCGGAGGACGTG SQR ... A FatB CAD32683 NP189147 CAC39106 NP193041 S40407 Q42712 AAA33020 AAG43859 AAL77443 AAG35064 AAB51523 AAB51524 AAC72883 Q39473 AAC49001 Q41635 AAD42220 AAG43857 AAG43858 AAG43860 AAG43...
Ngày tải lên : 12/08/2014, 05:20
  • 11
  • 243
  • 0
Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf

Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf

... containing 20–100 lM L -Phe as substrate and 30 nM L 1 or L 2 . Arrows in all figures indicate points of intersection. Inhibitor-binding sites of L -amino acid oxidase S. Mandal and D. Bhattacharyya 2084 ... Amersham Pharmacia Biotech (2001) Chromatofocusing with Polybuffer and PBE, pp. 15–24. Amersham Phar- macia Biotech AB, Uppsala. Inhibitor-binding sites of L -amino acid ox...
Ngày tải lên : 07/03/2014, 05:20
  • 18
  • 306
  • 0
Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx

Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx

... novel l -amino acid oxidase (LAAO; EC.1.4.3.2). LAAOs catalyze the oxidative deamination of an l -amino acid substrate and have been reported to exert antibacterial activity in a variety of animal fluids, ... trypsin and the amino acid sequence was analyzed using nanoFrontier nLC-Linear-Trap-TOF MS (Hitachi, Tokyo, Japan). Antiserum preparation and IgG purification An anti...
Ngày tải lên : 29/03/2014, 08:20
  • 13
  • 423
  • 0
Báo cáo khoa học: Novel c-carboxyglutamic acid-containing peptides from the venom of Conus textile docx

Báo cáo khoa học: Novel c-carboxyglutamic acid-containing peptides from the venom of Conus textile docx

... carboxylase and of Gla in phyla as disparate as Chordata and Mol- lusca suggests the existence of an ancestral carboxyla- tion system with a purpose predating blood coagulation and bone formation. ... reversed-phase HPLC (data not shown). Amino acid analysis and sequencing Amino acid compositions were determined after acid hydro- lysis, except for Gla, which was determined a...
Ngày tải lên : 23/03/2014, 11:20
  • 10
  • 437
  • 0
Báo cáo khoa học: Surface exposed amino acid differences between mesophilic and thermophilic phosphoribosyl diphosphate synthase ppt

Báo cáo khoa học: Surface exposed amino acid differences between mesophilic and thermophilic phosphoribosyl diphosphate synthase ppt

... unknown. In general, the number of individual amino a cids varied little among the two enzymes. Exceptions were asparagine, alanine, glycine a nd methionine. Analysis of the number o f asparagine and ... glutamine residues revealed a bias against these thermolabile amino acids. Both enzymes contained 10 glutamine residues. B. subtilis PRibPP synthase con- tained 17 asparagi...
Ngày tải lên : 23/03/2014, 13:20
  • 8
  • 514
  • 0
Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx

Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx

... NIS ȕ-actin R24 1A E7 9A D16 3A D23 3A D23 7A D31 1A D32 2A D33 1A ȕ-actin NIS w t R 9A R8 2A K8 6A H22 6A D23 3A D23 7A D31 1A D32 2A D33 1A R22 8A R23 9A R24 1A E7 9A D16 3A Blank Mock Figure 2 Expression and ... Shigaki T, Barkla BJ, Miranda-Vergara MC, Zhao J, Pantoja O, Hirschi KD: Identification of a crucial histidine involved in metal transport ac...
Ngày tải lên : 10/08/2014, 05:21
  • 9
  • 398
  • 0
Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... University of Adelaide Animal Ethics Committee. Acetylcholine, atropine, concanavalin A, CCK-8 and CCK-8-NS were obtained from Sigma-Aldrich. Alamar blue was obtained from Astral Scientific (Caringbar, ... pro- cessing intermediates. Am J Physiol 252, G315–G319. 39 Anastasi A, Erspamer V & Endean R (1968) Isolation and amino acid sequence of caerulein, the active peptide in the...
Ngày tải lên : 19/02/2014, 16:20
  • 11
  • 638
  • 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

... mutant a- actinin-2 (LXXAA) retain the primary and secondary coactiva- tor functions of wild-type a- actinin-2. In addition, a- actinin-2 not only serves as a primary coactivator in the AR, but also interacts ... function-2 of the AR and plays a role in AR dimerization [85]. The functional coregulator domain of SV is located at amino acids 831–1281 of bovine origin, whi...
Ngày tải lên : 07/03/2014, 01:20
  • 17
  • 573
  • 0
Báo cáo khoa học: Increased glucose metabolism and ATP level in brain tissue of Huntington’s disease transgenic mice pdf

Báo cáo khoa học: Increased glucose metabolism and ATP level in brain tissue of Huntington’s disease transgenic mice pdf

... concentrations in the posterior regions of intact brain in normal and HD mice The availability of an in silico representation of the glycolytic pathway in both normal and HD brain offers the potential ... by an early death at 10–13 weeks. Pathological examination of the brain revealed inclusions in the nucleus of most brain neuro- nes as early as 7 weeks of age, which we...
Ngày tải lên : 23/03/2014, 10:20
  • 16
  • 454
  • 0
Báo cáo khoa học: Functionally distinct dopamine and octopamine transporters in the CNS of the cabbage looper moth* potx

Báo cáo khoa học: Functionally distinct dopamine and octopamine transporters in the CNS of the cabbage looper moth* potx

... within the range reported for cloned mammalian DATs), our data suggest that DA is the primary natural substrate of TrnDAT and octopamine (and possibly tyramine) the natural substrate of TrnOAT ... insect; neurotransmitter; transporter; dopamine; octopamine; cocaine. The catecholamine dopamine (DA), the phenolamine octopamine (OA) and the indolamine serotonin (5-HT) in uence a varie...
Ngày tải lên : 23/03/2014, 20:22
  • 11
  • 431
  • 0
Từ khóa: