báo cáo khoa học: " Analysis of rice glycosyl hydrolase family 1 and expression of Os4bglu12 β-glucosidase" potx

... to original French government works MINIREVIEW Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* Peter Faller 1,2 1 CNRS, LCC (Laboratoire ... is a soft ligand and therefore shows a preference for soft metals. More- over the structures of metallothioneins are not rigid and hence there is little selectivity...

Ngày tải lên: 16/02/2014, 15:20

... Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) Werner ... tetrahedral silica units in poly(silicate) is an ester-like bond. In order to test whether silicatein – in addition to being a poly(silicate)-forming enzyme (silica...

Ngày tải lên: 18/02/2014, 16:20

... and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa ... Chakraborty S, Biswas S, Chakrabarti C & Dattagupta JK (2005) Crystallization and preliminary X-ray diffraction studies of the cysteine protease erva- tamin...

Ngày tải lên: 18/02/2014, 16:20

... details about the role of different resi- dues of the aglycone-binding site in the stabilization of ES à and the interdependence between the binding of aglycone and the positioning of glycone in ... (dimboa-Glc) was included to facilitate the visualization of the active site. (C) Agly- cone-binding site of SbDhr1, including the substrate dhur...

Ngày tải lên: 18/02/2014, 17:20

... problem of several possible answers and, in consequence, automatic evaluation has been tackled for years within another field of study: automatic summarisation (Hori et al., 2003; Lin and Hovy, 2003). ... definition of what is a correct answer, and a way to com- pare the correct answers to automatic answers produced by a system. For this purpose we present a Wikip...

Ngày tải lên: 20/02/2014, 09:20

... reports the isolation and characterization of the regulatory moiety of the multicomponent enzyme phenol hydroxylase from Acinetobacter radioresistens S13 grown on phenol as the only carbon and energy ... radioresistens S13 phenol hydroxylase regulatory component (Eur. J. Biochem. 270) 1437 Phenol hydroxylase from Acinetobacter radiores...

Ngày tải lên: 21/02/2014, 00:20

... stabilization of the Toc /Tic/ preprotein supercomplex. In this model, Tic1 10 forms the channel protein and also acts in the recruitment of Hsp93 in concert with the co-chaperone Tic4 0. The TPR domain of Tic4 0 ... 1175 MINIREVIEW Protein transport in organelles: The composition, function and regulation of the Tic complex in chlorop...

Ngày tải lên: 07/03/2014, 03:20

... (Paris, France): 5forGulox (forward), 5Â-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3Â; and 3rev- Gulox (reverse), 5Â-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3Â. ... Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase Beata A. Wolucka 1 an...

Ngày tải lên: 07/03/2014, 12:20

... Location of nucleolin- binding sites in both lobes, but not in the basic N-terminus of lactoferrin. (A) Schematic linear representation of the human lactoferrin (hLf) derivatives used in binding competition ... biological functions of Lf are relevant to this binding. Some of these Fig. 10. Prediction of nucleolin- binding sites in human lactoferrin (hLf...

Ngày tải lên: 07/03/2014, 15:20

... REVIEW ARTICLE Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis Tse Siang Kang 1 , Dessislava Georgieva 2 , Nikolay ... involving the side chains of Lys and Asp49 while the C-terminal carboxyl group of peptide interacts with the side chain of His48 of the protein. Enzymatic toxins from snake venom T. S. Kang et ....

Ngày tải lên: 14/03/2014, 22:20

... that the catalytic sites of the enzyme are functional and are distinguishable on the basis of bind- ing with the inhibitor. Careful analysis of Fig. 2 shows that inactivation of E 3 by trypsin and ... Council of Scientic and Industrial Research, New Delhi. Journal compilation ê 2009 FEBS 6727 UDP-galactose 4-epimerase from Kluyveromyces fragilis...

Ngày tải lên: 16/03/2014, 00:20

... of ACL-08: HLT, pages 710–718, Columbus, Ohio, USA, June 2008. c 2008 Association for Computational Linguistics Using Conditional Random Fields to Extract Contexts and Answers of Questions from ... Con- ditional Random Fields (CRFs) to detect the contexts and answers of questions from forum threads. We improve the basic framework by Skip-chain CRFs...

Ngày tải lên: 23/03/2014, 17:20

... 2011–2021 ª 2011 The Authors Journal compilation ª 2011 FEBS Heme binding to the second, lower-affinity site of the global iron regulator Irr from Rhizobium leguminosarum promotes oligomerization Gaye ... of heme binding to Irr from B. japoni- cum indicated that the protein has both ferric and fer- rous heme- binding sites [12]. To inve...

Ngày tải lên: 28/03/2014, 22:21

... gene and 3Â end of a signal peptide: 5Â-CAGAAGCGGAA GAAA GCATGCAAAGGCAGA-3Â (number 2), were used. In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene. Two others: forward 5Â-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3Â and reverse 5Â-AATTCTCATTA CTACCTCTGCG...

Ngày tải lên: 30/03/2014, 13:20

... 02 016 859 (F) 02 017 035 (F) AC1 213 66 (F) AC137 618 (F) AP008 211 (F) AP008 211 /17 403620 bp -17 407871bp/ chr 5 1 AK120998 (F?) 0 Os5bglu 21 02 016 862 (F) AC1 213 66 (F) AC137 618 (F) AP008 211 (F) AP008 211 /17 4 217 99 ... AP008 211 /17 4 217 99 bp -17 427364 bp/chr 5 1- 0 Os5bglu22 02 016 869 (F) 02 016 867 (aa 1 61) AC1 213 66 (F) AC137 618 (F) (AAV 313 58) AP008 211...

Ngày tải lên: 12/08/2014, 05:20