báo cáo khoa học: " Rapid and accurate pyrosequencing of angiosperm plastid genomes" doc

... found using the keyword systems biology actually reflect applications of systems biology approaches to biological systems resulting in new bio- logical insights. However, on the other hand, and ... Hormone, cytokinins Nicotiana tabacum Modeling and measuring of the dynamics of endogenous cytokinins in tobacco plants grown on media supplemented with isopentenyl ade nine, zeat...

Ngày tải lên: 14/02/2014, 14:20

... dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department of Biology and Biochemistry, University of Bath, UK 2 Department of ... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and...

Ngày tải lên: 14/02/2014, 22:20

... structure of cN-II showing interfaces A and B and the Mg 2+ site. The inset shows the tertiary structure of each subunit. Effector sites 1 and 2 and the active site are shown. Table 2. Effect of point ... Active and regulatory sites of cytosolic 5Â-nucleotidase Rossana Pesi 1 , Simone Allegrini 2 , Maria Giovanna Careddu 1,2 , Daniela Nicole Filoni 1 , Marcella C...

Ngày tải lên: 15/02/2014, 01:20

... 10 6 (10 0%) Guanine PRTFDC1 36 .1 ± 14 .3 2.9 ± 0.7 1. 36 ± 0.34 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) HPRT 9.9 ± 0.2 899 ± 11 7 406 ± 53 4.5 · 10 7 ± 1. 0 · 10 7 (10 0%) M. Welin et al. Studies of the human ... Gene duplication and inactivation in the HPRT gene family. Genomics 89 , 13 4 14 2. 11 Nicklas JA (2006) Pseudogenes of the human HPRT1 gene. Environ M...

Ngày tải lên: 15/02/2014, 01:20

... Y. Cai et al. 3584 FEBS Journal 276 (2009) 35753588 ê 2009 The Authors Journal compilation ê 2009 FEBS Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 Yuanheng ... subunit molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activi...

Ngày tải lên: 18/02/2014, 08:20

... inducible nitric oxide synthase; nNOS, neuronal nitric oxide synthase; nNOSr, reductase domain of neuronal NOS; NO, nitric oxide; NOS, nitric oxide synthase; NOSoxy, oxygenase domain of NOS. FEBS ... further test the validity, kinetics and thermodynam- ics of the through- heme pathway in NOS enzymes. Conclusions Although the NOS flavoprotein domain ha...

Ngày tải lên: 18/02/2014, 11:20

... et al. Hydrogen tunnelling in biological systems FEBS Journal 276 (2009) 39303941 ê 2009 The Authors Journal compilation ê 2009 FEBS 3933 MINIREVIEW Structural and mechanistic aspects of flavoproteins: probes ... flavoproteins: probes of hydrogen tunnelling Sam Hay, Christopher R. Pudney and Nigel S. Scrutton Manchester Interdisciplinary Biocentre and Facult...

Ngày tải lên: 18/02/2014, 11:20

... of the 50’s loop in the Clostridium beijerinckii flavodoxin: evaluation of additivity and the importance of interac- tions provided by the main chain in the modulation of the oxidation-reduction ... activity of Fld derives from its FMN cofac- tor. The Fld semiquinone is exceptionally stable and its midpoint potentials are quite negative. This is a direct consequence of the di...

Ngày tải lên: 18/02/2014, 11:20

... Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson 1 1 ... in GTP activation. F133 was mutated to Asn in an attempt to create a GTP-activated enzyme, and F13 3A was prepared and tested as a control. Neither of t...

Ngày tải lên: 18/02/2014, 16:20

... 5Â-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3Â and a reverse oligomer 5Â-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3Â. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 Â-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3Â and the reverse oligomer 5Â-GTAGGCCTT...

Ngày tải lên: 19/02/2014, 06:20

... from the archaea kingdom, indicating that the enzymatic activities of the MAPEG family are not present in these species or that these activities are catalysed by other enzymes. The absence of MAPEG members ... [57]. Isolation and cloning of the SynMGST and E.coliMGST The coding sequence for the SynMGST, corresponding to the complementary strand of the nucle...

Ngày tải lên: 19/02/2014, 17:20

... for Computational Linguistics Subjectivity and Sentiment Analysis of Modern Standard Arabic Muhammad Abdul-Mageed Department of Linguistics & School of Library & Info. Science, Indiana University, Bloomington, ... Workshop on Statistical Parsing of Morphologically-Rich Languages, Los An- geles, CA. J. Wiebe, R. Bruce, and T. O’Hara. 1999. Development and use of...

Ngày tải lên: 20/02/2014, 05:20

... 2008. c 2008 Association for Computational Linguistics FastSum: Fast and accurate query-based multi-document summarization Frank Schilder and Ravikumar Kondadadi Research & Development Thomson Corp. 610 ... Jagarlamudi, H. Suzuko, and L. Vanderwende. 2007. The PYTHY Summa- rization System: Microsoft Research at DUC2007. In Proc. of DUC 2007, Rochester, USA. L. Vanderwende, H....

Ngày tải lên: 17/03/2014, 02:20

... therapy. Adv Drug Delivery Rev 2008, 60:1241–1251. 1 Rapid and specific influenza virus detection by functionalized magnetic nanoparticles and mass spectrometry Tzu-Chi Chou 1 , Wei Hsu 2,3 , ... conjugation and performed the magnetic separation of influenza virus. WH conducted SDS-PAGE and MALDI-TOF MS analyses. CHW instructed the preparation of monoc...

Ngày tải lên: 11/08/2014, 08:20

... depth of coverage of 24.6ì in Nandina and 17.3ì in Platanus. The Nandina and Platanus plastid genomes shared essentially identical gene complements and possessed the typical angiosperm plastid ... Nandina domestica (Berberidaceae)Figure 1 Plastid genome map of Nandina domestica (Berberidaceae). Map of the plastid genome of Nandina domestica (Berberi- daceae), showing...

Ngày tải lên: 12/08/2014, 05:20