... Central Page 1 of 8 (page number not for citation purposes) Virology Journal Open Access Research Improved Efficacy of a Gene Optimised Adenovirus-based Vaccine for Venezuelan Equine Encephalitis ... number of infectious diseases. For example, ad-based malaria vaccines have been developed containing malarial antigens optimised for expression in mammalian ce...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Improved Efficacy of a Gene Optimised Adenovirus-based Vaccine for Venezuelan Equine Encephalitis Virus" pdf
... Access Research Improved Efficacy of a Gene Optimised Adenovirus-based Vaccine for Venezuelan Equine Encephalitis Virus Amanda J Williams, Lyn M O'Brien, Robert J Phillpotts and Stuart D Perkins* Address: ... universally applicable [43]. Gene optimisation has shown promise for a number of infectious diseases. For example, ad-based malaria vaccines have b...
Ngày tải lên: 12/08/2014, 04:22
... 811–819. 28. Lanzetta, P .A. , Alvarez, L.J., Reinach, P.S. & Candia, O .A. (1979) An improved assay for nanomole amounts of inorganic phos- phate. Anal. Biochem. 100, 95–97. 29. Farahbakhsh, Z.T., Huang, ... bandwidth was 1.0 nm, and ellipticity measurements were averaged for 3 s at each wavelength. All spectra reported are the average of five scanning accumulations. Thermal den...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf
... 5¢-ACTCAAATCACTAGTATTCTTCCACCA-3¢ and 5¢-CATTTGAACATAAACATGAACAAATAAGTT-3¢ and the following conditions: annealing temperature 55 °C, 25 cycles, Phusion polymerase used according to the manufacturer’s ... Viridiplantae), home-made databases that contain either a six frame-translation of C. papaya ESTs or a six-frame translation of C. papaya whole genome shotgun sequences. These databa...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf
... (TTTGTTTAACTTTAAGAAGG AGATATA CATATGAATCG) and AmyRev-NcoI (aaaac catGGGCTTTGTTAGCAGCCGGAT). The amplified fragment was ligated into the NdeI and NcoI sites of pSY1 [30]. A derivative (pSY-AmyH_KK) was ... mutated to twin lysines (AmyH- KK). The primers used for Quickchange mutagenesis were AmyKKfor (CCGGCAGTAAGCAGGCGTCTaagaaaACC GTTCTGAAAGGAATCG) and AmyKKrev (GGCCGTC ATTCGTCCGCAGAttctt...
Ngày tải lên: 23/03/2014, 06:20
báo cáo khoa học: " Usability evaluation of a clinical decision support tool for osteoporosis disease management" pps
... direct obs ervation of participants. Quantitative data Quantitative data were analysed using frequency analysis of demographic ques tions, task accuracy, and frequency and classes of problems encountered; ... Implementing a clinical decision-support system in practice: A qualitative analysis of influencing attitudes and characteristics among general practitioners. Informatics for...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học:" Psychometric evaluation of a radio electric auricular treatment for stress related disorders: a double-blinded, placebo-controlled controlled pilot study" pps
... process and data analysis. Thanks to Giorgio Saragò M.D., and Stefania Bini M.D. for help in administering the NPPO-REAC treatment and Alessandro Castagna M.D. for his helpful support. Author details 1 Medical ... Protective and damaging effects of mediators of stress. Elaborating and testing the concepts of allostasis and allostatic load. Ann N Y Acad Sci 1999, 896:30-47. 18. Stewa...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo khoa học: Multi-tasking of nonstructural gene products is required for bean yellow dwarf geminivirus transcriptional regulation potx
... still able to take place (albeit to a lesser degree) in the absence of an intact RBR-binding domain. We also demonstrated that Rep possesses a nuclear localization site that is absent from RepA, and that ... cellular RBR and E2F. The results of work presented in the present article suggest that a similar pathway of gene regulation may occur for BeYDV. However, the fact that tr...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: "Protective efficacy of commercial inactivated Newcastle disease virus vaccines in chickens against a recent Korean epizootic strain" docx
... Immunopathol 2005, 106, 259-267. 16. Mase M, Imai K, Sanada Y, Sanada N, Yuasa N, Imada T, Tsukamoto K, Yamaguchi S. Phylogenetic analysis of Newcastle disease virus genotypes isolated in Japan. ... Newcastle disease virus vaccine that allows serological differentiation between vaccinated and infected animals. Vaccine 2001, 19, 1616-1627. 19. Sakaguchi M, Nakamura H, Sonoda K, H...
Ngày tải lên: 07/08/2014, 20:24
báo cáo khoa học: "The efficacy of preopoerative instruction in reducing anxiety following gyneoncological surgery: a case control study" pptx
... 26:193-204. 15. Montazeri A, Vahdaninia M, Ebrahimi M, Jarvandi S: The Hospital Anxiety and Depression Scale (HADS): translation and validation study of the Iranian version. Health and Quality of Life Outcomes ... from the healthcare personn el. Emotional and psychological surgical preparation plays an important role in many areas of nursing. In the study of Wade et al (2000) it was...
Ngày tải lên: 09/08/2014, 01:24