Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... BioMed Central Page 1 of 5 (page number not for citation purposes) Virology Journal Open Access Research Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state ... sub- jects, which covers clinical characteristics, demographic characteristics and social behaviors, which could be possi- ble risk factors to acquiring HCV. Stat...

Ngày tải lên: 12/08/2014, 04:21

5 463 0
Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... Pirlich M, Balks HJ, Selberg O: Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences. Eur J Clin Chem Clin Biochem 1994, 32( 10):749-58. 9. Del Vecchio Blanco C, Gentile ... sub- jects, which covers clinical characteristics, demographic characteristics and social behaviors, which could be possi- ble risk factors to acquiring HCV. Statistical Analysis General...

Ngày tải lên: 12/08/2014, 04:22

5 209 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

... was conceived by cloning in psiSTRIKE the pre-mmu-miR- 328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). The Rluc:miR- 328 ... using forward (5'-gcgcgcggatccgccagccccct- gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac- cgctcggaagtcttcc-3') oligonucleotides, and cloned in the BamHI...

Ngày tải lên: 11/08/2014, 07:21

13 362 0
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot

Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot

... Reactivation of hepatitis C virus after chemotherapy for colon cancer. Clin Oncol (R Coll Radiol) 20 04, 16 :20 4 -20 5. 7. de Pree C, Giostra E, Galetto A, Perrin L, Zulian GB: Hepatitis C virus acute exacerbation ... NH, Gerlach JT, Jung MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, Cerny A, Pape GR: Association of hepati...

Ngày tải lên: 11/08/2014, 10:22

3 232 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

... T: The efficacy of blood donor screening in reducing the incidence of hepatitis C virus infection among thalassemic patients in Iran. Transfusion Today 20 02, 53:3-4. 7. Alavian SM, Einollahi B, ... was performed in 72 patients. Chronic hepatitis was diag- nosed in 57 and liver cirrhosis in 12 patients. No specific pathologic change occurred in only 3 patient...

Ngày tải lên: 13/08/2014, 13:20

6 337 0
Báo cáo khoa học: " Seroprevalence of Hepatitis B virus and Hepatitis C virus among blood donors in Nyala, South Dar Fur, Sudan" ppsx

Báo cáo khoa học: " Seroprevalence of Hepatitis B virus and Hepatitis C virus among blood donors in Nyala, South Dar Fur, Sudan" ppsx

... Homan C, Christensen C, Gretch D: High rate of spontaneous negativity for hepatitis C virus RNA after establishment of chronic infection in Alaska Natives. Clinical Infectious Diseases 20 06, 42( 7):945-9 52. 13. ... the reference value (5 -25 U/I) which indi- cate an acute infection, four were have mild ALT elevation (ALT = 28 to31 U/I) which indicate a chronic infecti...

Ngày tải lên: 12/08/2014, 04:20

4 436 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

... hepatocarcinoma in one study. [5] This same genotype was also found in 82% of 147 chronic hepatitis C patients in Chile as well. [48] Genotype 1b is also dominant in Japan. [ 72- 74] In Beijing, China, ... genotypes of hepatitis C virus in blood donors and in patients with Int. J. Med. Sci. 20 06, 3 41 International Journal of Medical Sciences ISSN 144...

Ngày tải lên: 02/11/2012, 09:56

6 486 0
Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

... response during acute and chronic hepatitis C virus infection. Proc Natl Acad Sci USA 101, 10149–10154. 52 Flint M, Logvinoff C, Rice CM & McKeating JA (20 04) Characterization of infectious retroviral ... receptor candidate can block viral infection. Assays to measure HCV infection have used three dif- ferent types of HCV particles: clinical HCV isolates, HCV pseudoty...

Ngày tải lên: 19/02/2014, 06:20

15 570 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

... present in the sequence are the two copper A (amino acids 86–96) and copper B (amino acids 25 8 29 4) binding motifs common to most tyrosinase sequences [3] that contain five of the six copper-bind- ing ... E B Fig. 2. Melanin formation on tyrosine con- taining solid media by E. coli cells express- ing V. spinosum tyrosinase constructs. (A) Escherichia coli transformed with vector contai...

Ngày tải lên: 06/03/2014, 11:20

13 779 0
Báo cáo khoa học: Fidelity of hepatitis B virus polymerase pptx

Báo cáo khoa học: Fidelity of hepatitis B virus polymerase pptx

... GT- M13mp18: -AAA ATC TGT CCT TGC CAT- Primer 121 2C: 5¢-GTT TTC CCA GTC ACG AC- M13mp18: -CAA AAG GGT CAG TGC TGC- 29 30 S. G. Park et al. (Eur. J. Biochem. 27 0) Ó FEBS 20 03 protein is the two HBV polymerases ... murine leukemia virus; ORF, open reading frame; PVDF, poly(vinylidene difluoride); RT, reverse transcriptase. (Received 24 March 20 03, accepted 2 May 20 03) Eur. J. Bioch...

Ngày tải lên: 31/03/2014, 01:20

8 411 0
Từ khóa:
w