Báo cáo khoa học: "Identification and characterisation of a novel anti-viral peptide against avian influenza virus H9N" pps

Báo cáo khoa học: "Identification and characterisation of a novel anti-viral peptide against avian influenza virus H9N" pps

Báo cáo khoa học: "Identification and characterisation of a novel anti-viral peptide against avian influenza virus H9N" pps

... 5'ATTTAAGGATCCGAGAGCCATGGA 3' pC-HA-R 5'ATGCTGCTCGAGTTATATACAAATGTTGC 3' pC-NA-F 5'CATAGAATTCGCAAAAGCAGGAGT 3' pC-NA-R 5'TATCGCTCGAGAGTAGAAACAAGGAG 3' pC-P1-FP 5'AGCCTGGAATTCATGAAAAAATTA ... NA, HA t and P1genes Primers Sequence pY-NA-F a 5' CATAGAATTCGCAAAAGCAGGAGT 3' pY-NA-R 5' TATCGCTCGAGAGTAGAAACAAGGAG 3' pY-HA t -F 5&ap...
Ngày tải lên : 12/08/2014, 04:21
  • 12
  • 288
  • 0
báo cáo khoa học: " Identification and characterisation of seed storage protein transcripts from Lupinus angustifolius" docx

báo cáo khoa học: " Identification and characterisation of seed storage protein transcripts from Lupinus angustifolius" docx

... awareness in many societies of the escalating incidence of obesity and the associated risk of diabetes and cardiovascular disease, NLL is an excellent candi- date as a healthy food. The major proteins ... resolution available for this analysis, it was clear that the spot was contaminated with BETA4 protein and this may explain why it appeared to bind IgE. Mass spectrometric anal...
Ngày tải lên : 11/08/2014, 11:21
  • 15
  • 559
  • 0
báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf

báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf

... were made. The 3’ sequence was used to make the primer 75ALerevECO (GGAATTCT- CAGCAACGATAAACGTCCAAAGATAG) with an additional Eco RI site for the 3’ end of the gene. The 5’ end primer, 75ALedirBAM ... quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biology 2007, 8(2):R19. 37. Slimestad R, Fossen T, Verheul MJ: The F...
Ngày tải lên : 12/08/2014, 03:21
  • 12
  • 433
  • 0
Báo cáo khoa học: "Identification and characterization of a new E3 ubiquitin ligase in white spot syndrome virus involved in virus latency" pot

Báo cáo khoa học: "Identification and characterization of a new E3 ubiquitin ligase in white spot syndrome virus involved in virus latency" pot

... largest viral genomes. Database searches reveal that more than 95% of these ORFs do not have any coun- terparts in other species and WSSV has thus been placed in a new virus family, the Nimaviridiae, ... interests. Authors' contributions FH carried out the experiments, analyzed the data and drafted the manuscript and JK contributed to the experi- mental design of the study...
Ngày tải lên : 12/08/2014, 04:21
  • 8
  • 387
  • 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... Seiichiro Ikeda 1 , Shinya Kajita 1 , Masaya Nakamura 2 and Yoshihiro Katayama 1 1 Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, Koganei, ... of 18 Ofromradio- labeled water was not observed with guaiacol. It was clear that the b-aryl ether cleavage enzyme catalyzed the addition of two molecules of H 2 O(atCa and...
Ngày tải lên : 17/03/2014, 03:20
  • 10
  • 670
  • 0
Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx

Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx

... chaffeensis strains available in the GenBank database showed that EC- PGHL was 100% identical or similar to the Arkansas (AF416764), the Sapulpa (U60476) and the 91HE17 (U23503) strains, all of these ... accession number AY35042) with the sequences of 20 E. chaffeensis strains available in the database showed that EC-PGHL was 100% identical or similar to the Arkansas (AF416764), the Sap...
Ngày tải lên : 07/08/2014, 18:21
  • 5
  • 353
  • 0
báo cáo khoa học: " Identification and analysis of common bean (Phaseolus vulgaris L.) transcriptomes by massively parallel pyrosequencing" doc

báo cáo khoa học: " Identification and analysis of common bean (Phaseolus vulgaris L.) transcriptomes by massively parallel pyrosequencing" doc

... developmental pathways. The second largest TF family in common bean (77) has similarity with the (NAM, ATAF1, 2 and CUC2) family as compared to 205 in soybean and 126 in Arabi- dopsis thaliana as shown ... of genesexpressedinthecommonbeanwillhelpinthe development of an accurate and complete structural annotation of the common bean genome, a valid tran- scriptome map, and the i...
Ngày tải lên : 11/08/2014, 11:21
  • 18
  • 279
  • 0
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

... pGEM-T clone (GenBank:DQ335596) as a template and the following pri- mers: CaNDR1-BglII 5’-TCAGATCTTATGGACA AAG- GATGGGGC-3’,andCaNDR1-BstEII 5’-T AGGTCAC CAAATTAATTCCCAGGAAA-3’.DigestedPCRpro- ducts ... GAC GTA CCA GAT TAT ATG TC AGA CCC CAG CAG CAG TGC-3’ and CaNDR1-Reverse 3, 5’-CTA ATG GTG ATG GTG ATG GTG CAA CAG CAG AAC CAA GAA A- 3’. The primers used for obtaining the single HA-t...
Ngày tải lên : 11/08/2014, 11:21
  • 17
  • 455
  • 0
báo cáo khoa học: "Identification and analysis of phosphorylation status of proteins in dormant terminal buds of poplar" pptx

báo cáo khoa học: "Identification and analysis of phosphorylation status of proteins in dormant terminal buds of poplar" pptx

... regulated during the release of dormancy, such as acetyl-CoA carboxylase (ACCase), chalcone synthase, chalcone isomerase, and f lavonol syn thase [12,65- 67]. Acetyl-CoA carboxylase (ACCase) catalyzes ... out experimental work, participated in data analyses, and drafted the manuscript. CFL and ZYS participated in the design of the study and performed in silico analyses. All author...
Ngày tải lên : 11/08/2014, 11:21
  • 16
  • 343
  • 0
báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx

báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx

... Omura Y, Abe K, Kamihara K, Katsuta N, Sato K, Tanikawa M, Yamazaki M, Ninomiya K, Ishibashi T, Yamashita H, Murakawa K, Fujimori K, Tanai H, Kimata M, Watanabe M, Hiraoka S, Chiba Y, Ishida S, Ono ... Y, Nagahari K, Murakami K, Yasuda T, Iwayanagi T, Wagatsuma M, Shiratori A, Sudo H, Hosoiri T, Kaku Y, Kodaira H, Kondo H, Sugawara M, Takahashi M, Kanda K, Yokoi T, Furuya T, Kikkawa E, Omura...
Ngày tải lên : 11/08/2014, 11:21
  • 13
  • 417
  • 0

Xem thêm

Từ khóa: