Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

... SVT2 cells. The incubation was performed (A) in the absence of iodoacetamide (IAM), (B) in the presence of 10 m M IAM, or (C) of 50 m M IAM. D and M mark the elution volumes of BS-RNase and monomeric ... dimerization event occurs outside the cells, before internalization, we investigated the role of plasma mem- branes (PM) in the transformation of MSSAE...

Ngày tải lên: 20/02/2014, 11:20

8 605 0
Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

... infected APCs. Conclusion: These results suggest for the first time that the JAK-STAT1 pathway is involved in blocking replication of HSV-1 in DCs and macrophages. Backgrounds Macrophages and DCs are ... 5'-CAGTAGCGTGGGCATTT- TCTG-3'; reverse primer, 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Amplicon length = 59...

Ngày tải lên: 12/08/2014, 04:21

13 267 0
Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

... purposes) Replication of HSV-1 in macrophagesFigure 5 Replication of HSV-1 in macrophages. Analyses of virus replication, viral gB mRNA, and viral genomic DNA in macro- phages was done as in Fig. 2 for ... number not for citation purposes) Virology Journal Open Access Research A role for the JAK-STAT1 pathway in blocking replication of HSV-1...

Ngày tải lên: 12/08/2014, 04:21

13 468 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

... early as after 5 days of culture, and a maximal plat- eau of storage was already seen at day 12. Both pro- CPA and mature CPA were detected in SG + ⁄ + cells. A dramatically different pattern was ... detected at day 0, the intracellular content of this enzyme increased markedly after 6 days of culture, and reached a plat- eau from about day 12 (Fig. 2B). Both the ki...

Ngày tải lên: 07/03/2014, 11:20

12 438 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC VK3.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA JH1-2.link CCACCAGAACCTCCGCCTCCTGATCCGCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo khoa học: "A Program for the Machine Translation of Natural Languages" pdf

Báo cáo khoa học: "A Program for the Machine Translation of Natural Languages" pdf

... information-retaining cells. The information retained by any particular group of cells at any one time may be called the state of this part of the automaton. The state of the entire automa- ton ... what we have been calling a translation. The domain of this translation function is a certain class of texts in some language, and its range is a class of...

Ngày tải lên: 23/03/2014, 13:20

9 458 0
Báo cáo khoa học: "A TOOL FOR THE AUTOMATIC CREATION, EXTENSION OF LEXICAL KNOWLEDGE" pdf

Báo cáo khoa học: "A TOOL FOR THE AUTOMATIC CREATION, EXTENSION OF LEXICAL KNOWLEDGE" pdf

... contain pointers to the different forms belonging to their para- digm, and information relevant to all forms of a para- digm: e.g. case frames and semantic information). The corresponding ... responsible for computing the regular paradigm, which analyses this information and transfers control to an object computing forms of verbs belonging to a particular category...

Ngày tải lên: 24/03/2014, 05:21

5 467 0
Báo cáo khoa học: "A Language for the Statement of Binary Relations over Feature Structures" ppt

Báo cáo khoa học: "A Language for the Statement of Binary Relations over Feature Structures" ppt

... and the range by those labelled 'L2', or vice versa. One may then think of compiled transfer rules as having a 'left-hand' or 'input' and a 'right-hand' ... its interpretation, outline two alternative rule application regimes, and illus- trate the use of the formalism in the areas of machine translation and reduction of...

Ngày tải lên: 01/04/2014, 00:20

6 348 0
báo cáo khoa học: " A role for neurotransmission and neurodevelopment in attention‑deficit/hyperactivity disorder" ppsx

báo cáo khoa học: " A role for neurotransmission and neurodevelopment in attention‑deficit/hyperactivity disorder" ppsx

... (SNPs) investigated in these six genes, an association with BAIAP2 was detected, by both the single- and multiple-marker analyses, in the adult ADHD Spanish sample. In the replication study, the ... (DAT1) in ADHD families. Using the family-based approach called ‘haplotype relative risk’, an association with the ten- repeat allele was detected. In the following...

Ngày tải lên: 11/08/2014, 12:20

3 329 0
Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

... 5′- CCTGCGTCGAGA GAGCTC-3′. To quantitate the viral amplicon, a TaqMan dual 5′-6-carboxyfluorescein -and 3′-6-carboxytetramethylrhodamimine-labeled probe was used: 5′ -(FAM)-CAGTGGCGCCCGAACAGGGA- (TAMRA)-3′ ... integrase-mediated joining occurred, and thus again manifests as a decrease in the Alu-PCR signal [25,26]. HDAC4 is involved in PIR in ATM-deficient cells HDAC4 is...

Ngày tải lên: 12/08/2014, 01:21

10 386 0
Từ khóa:
w