Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot

Báo cáo khoa học: "Image guidance using 3D-ultrasound (3D-US) for daily positioning of lumpectomy cavity for boost irradiation" pptx

Báo cáo khoa học: "Image guidance using 3D-ultrasound (3D-US) for daily positioning of lumpectomy cavity for boost irradiation" pptx

... conceived of the study, and participated in its design and coordination. AY participated in the coordination and statistical analysis. CG and RM performed data acquisition on all images and contributed ... that has infrared reflective markers affixed to its handle. The markers are tracked by an infra- red camera to determine the position and orientation of each ultrasound fram...

Ngày tải lên: 09/08/2014, 09:20

11 270 0
báo cáo khoa học: "New clinical developments in histone deacetylase inhibitors for epigenetic therapy of cancer" doc

báo cáo khoa học: "New clinical developments in histone deacetylase inhibitors for epigenetic therapy of cancer" doc

... Musguire LA, Stoller RG, et al.: Phase I and pharmacokinetic study of vorinostat, a histone deacetylase inhibitor, in combination with carboplatin and paclitaxel for advanced solid malignan- cies. Clin ... 2005, 104: 2717-2725. 92. Chavez-Blanco A, Segura-Pacheco B, Perez-Cardenas E, Taja-Chayeb L, Cetina L, Candelaria M, et al.: Histone acetylation and histone deacetylase activity...

Ngày tải lên: 10/08/2014, 22:20

11 403 0
Báo cáo khoa học: "Drotrecogin alfa (activated): current evidence supports treatment for severe sepsis patients with a high risk of death" ppsx

Báo cáo khoa học: "Drotrecogin alfa (activated): current evidence supports treatment for severe sepsis patients with a high risk of death" ppsx

... 344:699-709. 3. Abraham E, Laterre PF, Garg R, Levy H, Talwar D, Trzaskoma BL, Francois B, Guy JS, Bruckmann M, Rea-Neto A, et al., for the Administration of Drotrecogin alfa (activated) in Early Stage Severe ... estimate to the left of the line of identity (1) favors treatment with Drotrecogin alfa (activated) and an estimate to the right favors placebo. A 95% confidence...

Ngày tải lên: 13/08/2014, 03:20

2 212 0
báo cáo khoa học: "Combined mirror visual and auditory feedback therapy for upper limb phantom pain: a case report" docx

báo cáo khoa học: "Combined mirror visual and auditory feedback therapy for upper limb phantom pain: a case report" docx

... participated in data collection, case writing and critical review of the manuscript. All have read and approved the final manuscript. Competing interests The authors declare that they have no competing ... sensory and visual feedback. In an amputee there is no verifica- tion, resulting in a c onflict between the incoming and outgoing of information to the cortex. Interes...

Ngày tải lên: 11/08/2014, 00:22

4 376 0
Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot

Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot

... limited molecular capabilities. Findings Classification of seasonal influenza A into H3N2 or H1N1 subtypes is an important step in the characterization of circulating influenza A strains. The recent ... influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada Shelly Bolotin*...

Ngày tải lên: 12/08/2014, 04:21

3 246 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

... protein, lacking the copper binding domain is cap- able of domain swapping and forms a dimer as revealed by crystal structure analysis [36]. In our case, SEC data collected for samples at pH 7 have ... nm. Acknowledgements We thank Louise Kroon Z ˇ itko and Manca Kenig for cloning and isolating the recombinant proteins. We also are grateful to Sabina Rabzelj and Sas ˇ a Jenko...

Ngày tải lên: 19/02/2014, 06:20

14 586 0
Tài liệu Báo cáo khoa học: "An Information-Theory-Based Feature Type Analysis for the Modelling of Statistical Parsing" docx

Tài liệu Báo cáo khoa học: "An Information-Theory-Based Feature Type Analysis for the Modelling of Statistical Parsing" docx

... decision-tree models for parsing. In Proceedings of the 33 th Annual Meeting of the ACL. Mitchell P. Marcus, Beatrice Santorini & Mary Ann Marcinkiewicz. 1993. Building a large annotated corpus of English: the ... Predictive information redundancy can be used as a measure of the redundancy between the predictive information of a feature type and that of a...

Ngày tải lên: 20/02/2014, 18:20

8 504 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

... 504 TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576 TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC 648 CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG ... 144 CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216 GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288 CT...

Ngày tải lên: 17/03/2014, 09:20

11 527 0
Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

... was achieved. As in the case of CII [10,11], CIII appears to work as an inhibitor for the proteoly- sis of r 32 through direct interaction with the protease, characterized by a lack of interaction ... (1988) The role of the Escherichia coli DnaK and DnaJ heat shock pro- teins in the initiation of bacteriophage k DNA replica- tion. Proc Natl Acad Sci USA 85, 6632–...

Ngày tải lên: 23/03/2014, 10:20

6 454 0
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt

Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt

... presence of weak organic acid preservatives is an important cause of food spoilage. Many of the determinants of acetate resistance in Sac- charomyces cerevisiae differ from the determinants of resistance ... transketolase reac- tion [19]. Weak acid stress in yeast is acting in a fundament- ally different way. It is not generating an auxotrophy for aromatic amino acids...

Ngày tải lên: 23/03/2014, 21:20

7 391 0
Từ khóa:
w