Báo cáo khoa học: "Identification of a novel picornavirus re

Báo cáo khoa học: "Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea" pps

... report Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea Lori R Holtz 1 , Stacy R Finkbeiner 2 , Carl D Kirkwood 3 and David Wang* 2 Address: 1 Department of ... to a new genus, cosavirus. These viruses were found in the stools of both healthy children and those with acute flaccid paralysis in Pakistan and Af...

Ngày tải lên : 12/08/2014, 04:21

5
321
0

Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx

... S1. Amino acid alignment of linker region and ligand-binding domain (LBD) of ecdysone receptors. Fig. S2. Amino acid alignment of linker region and ligand-binding domain (LBD) of ultraspiracle ... shift band. All extracts were equilibrated by b-galactosidase activity prior to loading. Densitometry readings corresponding to designated shift bands are indicated below the image and a...

Ngày tải lên : 18/02/2014, 08:20

12
627
0

Báo cáo khoa học: " Identification of PCR-based markers linked to wood splitting in Eucalyptus grandis" pdf

... several DNA fragments. This in - creases the chances of finding fragments that are linked to more than one gene. A large number of fragments have to be screened and a large number of models have to ... [6]. All the resulting bands were scored on a scale ranging from 0 to 4 according to the intensity of the bands. A score of 0 rep - resented the absence of a b...

Ngày tải lên : 08/08/2014, 14:20

4
460
0

báo cáo khoa học: " Identification of candidate genome regions controlling disease resistance in Arachis" doc

... 2008, 146(1):5-21. 60. Sato S, Nakamura Y, Kaneko T, Asamizu E, Kato T, Nakao M, Sas- amoto S, Watanabe A, Ono A, Kawashima K, Fujishiro T, Katoh M, Kohara M, Kishida Y, Minami C, Nakayama S, Nakazaki N, Shimizu ... cM with A genetic linkage map of the A- genome of peanut – Linkage Groups A1 to A5 Figure 2 A genetic linkage map of the A- genome of peanut – Linkage Groups...

Ngày tải lên : 12/08/2014, 03:21

12
350
0

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... Mexican origin. The index case was a 23-year-old female diagnosed with breast carcinoma of the left breast with combined histological fea- tures of lobular carcinoma and infiltrating ductal carcinoma. ... performed according to a touchdown protocol with initial denaturation at 95°C for 5 min and final extension at 72°C for 5 min, denaturation at 95°C for 30 sec, annealing at...

Ngày tải lên : 09/08/2014, 04:21

7
403
0

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... 739 temperature of 340 °C, which was maintained for an addi- tional 5 min. The He carrier gas ﬂow was maintained at 1mLÆmin )1 using a split ﬂow of 1 : 20. The splitless time was 3 min, and the injector ... a- tocopherole acetate (1 mgÆmL )1 ) was added as internal standard to each assay prior to extraction. The conversion rates were determined by calculating the decrease of subs...

Ngày tải lên : 07/03/2014, 03:20

12
497
0

Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps

... (ELISA). A micro-ELISA plate (Nalge Nunc International, USA) was coated with 0.5 µ g of pAPN per well in carbonate-bicarbonate buffer (pH 9.6). After overnight incubation at 4 o C, it was washed ... protein binding assay (VOPBA) was used to identify PEDV binding protein in permissive cells. The binding ability of PEDV to porcine APN (pAPN) and the effects of pAPN on infectiv...

Ngày tải lên : 07/08/2014, 17:22

7
463
0

báo cáo khoa học: " Identification of novel maize miRNAs by measuring the precision of precursor processing" ppsx

... UAUCUAGAAAAGCCGAAACGA 0.44 0.08 0.07 1.05 family20 miRNA24 21 AAAGCUAGAACGACUUAUAAU 0 0 0 1.25 family21 miRNA25 22 UCAGCGCCACCACGAUGACCUC 0.15 0.08 0.61 0 family22 miRNA26 22 UGAAACAAGUAUCUCGAGAGCA ... AGAGACAAAAUACUGUAGAA 0 0.42 0.95 0 family30 miRNA34 21 UGGACAGGGAAAUGAAGGGGA 0.15 0 0 3.14 family31 miRNA35 21 UAGUACAUGGACCUAGAUGAC 0.59 1.5 0.47 18.81 family32 miRNA36 21 AAAUUAUAGGGCAUUUUUAU...

Ngày tải lên : 11/08/2014, 11:21

14
389
0

báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

... ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure ... L E L E 601 aagcatcttcatgatcaattagagatgcaaatgaatttacaaaagctgattgaggatcaa K H L H D Q L E M Q M N L Q K L I E D Q 661 gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataa tttgag G K Q V K .....

Ngày tải lên : 11/08/2014, 11:21

14
400
0

báo cáo khoa học: " Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms" potx

... Imai A, Akiyama T, Kato T, Sato S, Tabata S, Yamamoto KT, Takahashi T: Spermine is not essential for survival of Arabidopsis. FEBS Letters 2004, 556:148-152. 39. Imai A, Matsuyama T, Hanzawa ... Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y, Kato T, Hayashi H, Shibata D, Tabata S, Komeda Y, Takahashi T: Spermidine synthase genes are essential for survival of Arabidopsis. Plant Phys...

Ngày tải lên : 11/08/2014, 11:21

14
573
0